Description :
From Genome Similarity Track
Location :
Scaffold_65:278235- 281519
Sequence
3284 bases(100 bases per row)
TTAAGTCAATGGATCATGATAGGTGTATGTTAATTTTGTGCGTAATTAGTGATAAGTTGAAATATTTAATATATTATACAGATAAATCGGCCACATTTTA
TATGACCCGAGGGACGAAATTGTATCATATATAACAAGAAGATTCAATTGTAGAGGTACGAACGCCCTTAATTCATTTGCATCCCTCAAAAATAGCAAAG
GAGCCCGAAACTGTGTTCAGCAGCTCATTCCAGCACAATTCTACTTGGAGCATTTCTTCACTCGCCCTCACCGCGCAACAATGATGCCGTCGTGACCAAA
ACAGATTAATAACCTGACTTATGAACAGAAGAAAAAGATTCTCCAGTGGCATGACGCAAACGCTACTCCCACATAGTAGCATCTGGCAGCCAAGGCGAAG
CGAGAGTTTGGAATCTTTAAGGCGCCATCCCAGGGGACGATATCCAGTATCGCTAGGTGTTTCTGCACGTGAAGGAAGTCGACCTCAAGAGAAAGCGGAC
TCGAGTGCTCGCGCTACCTGCAATCGACGAGGCCCTTTCGAACTGGGTGGCAGTGTCAAGTCAAGCGCGCGATGCTGAGCGGTGATATGGTCAAGGCGAG
ATCGGTGCAGTCCGCCATGTTGAGCGGTCCCCCAGACAACCAGCTGACGTCGATTTTAAACGGGTGGCTTTAGGCGTTCCTGGGAAGGTCACGGATTCAA
GCAACTTATCGCCCACGGTGATAGCGGCTCCGTGAACTCGGAGGTGATACCCACGCAGCGCGACGCCATCAGAGACTGCCTAAACGGGGGTCTTACTTGC
TTACATCTACTACATGGACAAAACGGGACTGTTTTACTACATTGCTCCTGATATACCATCACCCTTCGACAATTGAAACGATCGAAGAAAAGAAAGAATC
GTGTGACAGATGCTCAGATGTGCAACGCTCAAGGCTCAGACAAACGCGAGCCGTTTATCATTGTTCACGAGAAGAAGCCACGCTGTTTACAGAAGATTAC
AGAAGTTTAACTTGTCTTCTACTATCGCAGCAACTTCAAGGCGTGGATGACATGTGTCCTATTCCCAAAGTGACTGAGTGAGCTTAACACCAGCATGTGC
GCTCAAAATAGCAACATCGTTCTCCTCCTCAACAATGCACCGACGACCGATTCTCAAGGAATGGAGCTTAAGAGCGTGACACTCGTGTTCCTTCTTTCAA
ACACGACCGCATAGCTGCAGACCATGGACGCCGGTATCATCGCAACGTTCAAACGTCGATATCGCACCGCCAGCTCGAGCACGCTTTGGATGTGGAGGAA
CAAGTAGAGCAGGCCAGTATCTAGATGCTGGACCAGCTCACGGCGATGAAGCGGATCAAATCCTACTGGCGCGAGGTTCCAAGAGATGCTGTTATGAACT
GATTTAGAACACAGGGCTCGTGTTTGTCCGTACGACCACTCGCAGATCGCGCATTGACGCTGATGACCAATTGAACACCAGCCTGCTGGCACAAATACTT
CAGCTGTGCATCCGCGATCCGATGGACATGAACGACTTTATTTGTTGCACCGCCAAGGCTGACACAAAGATGAAAGCACTGACTACCACATCCCTTTTCA
GCTAAGAAGCAGACGCCGGGTTCCTGTTCACGGCCTAAGATAGCAGCGACTTTACAGAGTCGTAGTCGACAAGCGAAGGCGTCATCAACACTCAGCCAGA
GATCAGCGTCGAGGAAAAACTAGACGCAGTTCGATCCATCCTTTTTTTGATAGGTTACAATCCAGATTTATAGAGACTTATCATGTCCGGGATGCGTGCA
TTCCAGCAATGATTGCTCGAGGAGCTGAGGCTAGAAAGGAAATGGTCAATCACAAAGATGCTACTTCGCGGATCTTCTCTGTGGCACCAACCATTCAATA
ATTCCAAGACGATAACTAAGCGATCTTGATAGCACGTTTCAAAACCGCCTTGTTAAACGTGTTATCTTAATATGAGCACGATCGCTGCGTGCACCTTCTG
CTCCATGTCCGCTGACAAAATCAACCCGCCCTCCACAACATCCCATAAGCCGTTTGATATGAGGTACATATTCAACTTGTACGCCCATATCGTGTTGTTA
ATTCCGTTAATACAGTTCCATTTCGAACACGGAGTTGACGCTTAGGCTCATAATCTGTTAAAGGGGGGTATAGGAGGCGGAGATTAGATCTGCGACTGAA
GTAGTATAACTATAAGTTAATTGTTTTATGTGTCGAAGCTTGCTAACCATTCCTATGCTTTTCTTGGATAGTTCACCTATCATATCCGATAAAAAAAGGT
CGATCATTCGTCATTATCAGGTTTCTTTCTCTCGGATGTGGCTTTTTCTTCTCTTTATCTCTGATGGGCTATATCATGAAAGTTGAAGGACGTCTCTTCT
TACAGAGACAGTGCTGGTGAACCCCCCTAGGCCAGTGCTGGTCAATTTTATCCTTTTTTCACTTCCTGCTCGCGAATCAGTGACTAATGATTTGACGTTG
CTACACCAACCCACTTGAGCTATTATTTTGGAGTACTAAGCAGCTCCAGACGTACATTTTTGTACAGCCGCGTCGCCTGCAGCTAACAGAACGTAGAAAA
CCTTTTAGCTTTCGAATAATCTCCAAATGAATAAACTAATGTGCAATACACGCAGGCAGGTTTTGAACCGATGCTAGTTCCGCGGATGGATCGTGCCCAC
ACTAGTGACCCACACATCGGCCCAAGAATTATTAATTTCCATCAAAATTATTGATCAAGTACGAAGTCTGCTCGATATCAAGTATACTCAATACATTTAA
ATAGAACCCCGAACTGGTGGATCAACACCTTATCATAAATAGCAATATATTATGTTTTCAGGGATCAGTTTAGCCAGGTTTATCTTTATAGGGTACAAAT
AGGGAGTTGTTAGATTCACTCCCTTTTCGGTTAGATTCACTTCTCTTTTCTTTCATCAAGTATACATTCATAACAGCCAATTATGATTGGTAAACGTACT
ACTCTGTCCCATTTGTTCATGGACTGAAAGTTATGTGAGCTACGTGAACTATTATGACTGGCTAAAAATCAACTCTTTTTTGGTCCAGTTTGTTTGGCAA
TTCATCAACAAAGACAAGCTATCTTGATGCGTTGCCAGTGATCGCTCGTCAGCGAGAGTAATCGCTGTTGTCGCTCATTTTTGAGCTGTAGCATCTGCGA
TGCCGCTGGGACTGACTGAGCCGAACGTGCACCCTACGAAGCGCGTTGTGGTTGTGCTTTTCTTGAGCATACGCACACAGGGAG