Description :
From Genome Similarity Track
Location :
Scaffold_40:278226- 284220
Transcript NameFunction/comments
Phyca_LT1534551060PREDICTED: ribonuclease H2 subunit B
Phyca_LT1534120218predicted protein
Phyca_LT1534508953Transcription intermediary factor 1-alpha

Sequence
5994 bases(100 bases per row)
aagtcaattcactcttgacaacgtgcaatgggccgcaagcagatcgcactggtgccatcagggctgccttcctcgaacttggggcgtttccactcggacg
caactgatgcccctttcctctctgtagtgtcgtggacctctcgctccagtgaagagtccacgcggacgcggcaattagctctggacaaggacaaacgtca
actattggagctacagcgactgcagcctgaggaaggcgcgcgcagctggtttgtgggtaattgcgtgcttcaagatggaggagtgatggtcttctcgcct
attgacgcactgttcgtgctgctggacgctgcgtggcctcaacgcacgcgcttctcgtctgtctacgatctgctggctagggaccacaacacgtggttgc
tgcagctctcgatgctcactcaggaggagatcgagactatctttgatgtgcaggcggttggaggggaggaaggagtggataatctttacgttaaggcgaa
cgagagcaaagttaggcgctggttgagggtaaaagtggagaaagtggcaaatgtactagcgcaacaggagctccaagcttcaaggaaggctgcagtggat
ggacaagtgatgctgccgggtgttaaacagacagagcagaagagcaatgtagtgacggatggagatgtggcgagacattatcgagaggctattgatattg
tggggaactatctgtctgaagagtggatcgacctgctgtgcaatgaattacggtaagttttattctgaagtattcgtaaatcataacctaacaattccta
tttgtccgatagggtgaagaaggtggtggaagttgtcaaggcggctaaggcggctgtgccactggatacgttcaagcggttcgatcgtcgacaggcacct
gaaaacggcagtaagagaccaacaccatctgctacgaatgcttcaaaaaagaaaagcaaattagccaatgtggatcgttcgggtatgaagtcgctcacgt
cgttttttgggaagaagtagaggcagaagatatccaagcgatgcattgagcgaaatatatagagctgtctatcttcgtgacgtggaaccttccacgctga
cacgatgcactatcacgaagtcgtcccagccggagaggatcttgaacttgaggaaggaagcatcagtaggtttgacattctcgctaacgatctgcatctc
tccgtcggtctctttcaactctggcaatacgattcgcgatggttagtacggtgaagaacagatcaagcaatttgatctgtactactaactcgtgtcgaac
agtttctcccattttgtaggtgtcgggccactgcacgattcgatcgtcatctctttcacgtttcgcgtccacattttggcacgaacgacggaggctgtcg
tcgccaattgcaccacgatttcttgtggaaagcttccagtcgtcacccatttggacgattgttccctgctcaatcaacaacacaaaagagtaaatggagt
gaagcttgcaagctcacaattcgttcatgtttacccgtccaagatattaaccggtgggaagcttggatcatatgaagtcaccgccgtcacctgagcacct
tcttcatccaaggcgagctccatcacgacgtctgaaggctgttgtgaatgtggctagttctcacggtacatgcctttacttagaaacgacgcacaatgta
ccccaataatagctgacggcatgcactcatacttatcgtcttgatttgcaagcacctaccactcgaccaactcaatgaagttgctcactagttcgaggtc
aacggcggctcaatagactctttatacaagcgttcgaagcctgccgatagaatgtccgccgcacgcgtgatacccgacccgtcatcattgaaaattttgc
agttcgaccacatcaggcgaatgtcgttggcaaagtgcgtgaaatccagttccttcacgccagacgccacggtgttgctgtccacgatgtacgccccctt
cttcagcttagtctcgatcttggacagatccatcggttgcttgaccaccttagtgtacataggcacgttttccaccggcgtcaggaacggctttgaaaac
ggatgcgacttcaagcactcgacaattttcagacacttgtctagcaggctctgctcggaagccaccgccgtagaatacgcatcgaaccgcgatggctttc
tgcattccttgcactgccagtcaccttcaggcaggtcgttctccgtcatgtgcaagcacttcaagtggaaggaacgcgggcatttgtcacagcaaaccag
atcaccggcgccttggcacacctcacagaaatctaaattcgtgtccaattcactgtccgaagcacctcggccgtctcgttcgtcttcgtcgtcatcatct
tcctcgtcgtcttccgctcggtaagtctcttcctccgtctcgtcgtcctcttcactcaatcgtttgcggcgttttgggggtctacctcttccccttttca
caggcgtgttagtttttttctggttacttgtgtacccttcaggaagaggatgcttacgagggcgtcctggtccacgatgcagtggtggagccggtgcgga
tggtttcagatccaacacagaatggtttcctgctatctcagtcttggggccattctccatcttatgagagtcggccttcgcactaagtattgggcttcca
tcagaatgacttttacgcatcacctcattcgcctctcctttcactgcaccttcagtacgggcatcatctcgtgatgacacatcgtccgagtcgcgttgca
cgggacgttcctctgtttcgctttcactagccgtccgcaccgggtattcctcgattggccgcgcaccaacagttggacgccgtggactatcatccgaatc
gattgagctagtggacgaatgtccctgaaatgggcttccaggttggcgacgtcgttcaccaacatcagagttcgtctgaggggccgtctccatgtcgaca
tcagaaccttgggtgttttcgcttctcggtgcaattccattcgaactcggacgtgattcactcgaaaggctggtggtggagttcgcaggcttctcacctt
gattcagcgtgctcagtaactggaccagagacttctccgactcggcgcagttaatgacggttgtcgctgatggagattccatagagccttgctgaacaag
cgacgatgcagctcgagcagcaacacgagaatccggagcagtactagcctttacagataacttatcggctggtgtatcctttgctgcgcgcttcggaacg
gcagcgtgatgagatggagacttcgactgtgtctgcatgctaggagcataaccatcacgagtattccgctcatccgattcatattcggcctgcaatcgcc
tgcgctcttcatacgtttctttagcttcagcaccacgaatagtgaatccttcacgttgaataggaggacgcgcttctgctggtggggtggggcgctggac
aaagcgacggccattgctaccatccacattgggagcactgccataggtcaatcggccttcagaggtcggagtagatagagcagtcgtaacaggagcggta
gtggcacgatcgtctttcaccgcagtcattaagccctggccgctacggcgcagcgtatccagaagatagcgcttgtatttctgcacgtcctgctccttct
ccgcagtgcatccggtgcacggacacccacgagtgcagatcagacagcgcaacaggcggcgattcggggcagatccgttcctgccaacgaataaagcttc
catgcgtactctgtaaacgctgcgtagatgctcccgacacagcgaatggttttcatctgcatgtgggcagaaatttaccacaggcacatagttcttttca
ttcaccccgcacagatgacacagtcccttggcaatgaagttggcttcctcttctggaatcaagtcctccatcgcgacggcaaacgcatcatgcaggacgg
actcatccaagttgacctgttctctaagcatttcctccaccctgggaggtagcttcctatccctcttgtagtcctcggccatctttcctgaagaagaagt
tggcaccggtcggttctgatacaccttgcttgcagtagaaccgtccacaactttcccctggtaagcaggggaaccctggataagtctaccttgatagggc
acagatccatctgccattctcccttcgtagcctgcaggtccattgatcattctctcctgatatcctggtggtggattcatctgccttccttgatatcctg
gcgctccgtccatcggccttccctggtatcgtgagcgtgaatccatcgttttagtttggtagccaggagaattatctatcgttctcccctgataagtagc
agaagtaaccaccgttctcccctgataaggagaaggagtagtcgctgatctcgaatgatagacagtcggtccatccattgctttcccttggtatcctgtg
tccatgggccttgtctggtaacctgttgggtggtcaggagctctcccctgataaccgacaggtcgttctgcctcccttccttggaatctcgaggctgcag
tgtgatgctggtattgcgtagctcccggaggcactgatgattggggagctgcccaatcatttgatctcgctcggtcttgccaagctccagcggacgatgt
agccaccccgcgggccgatacggccgaggcggggatgtagccatctggtgttttgcccttgctcatgatggcctccatccacacttcattgggcgggggc
gtaaggcgctgacgcttctaaagtagataattttgtattaaaaagaagaagaagagaaagagcgttagcagggggagaggaaggggagaacacgacacga
agaacagcaccttgtccccacggtctcgagctgctccatggtacatgctgctaacctctaaccgcttcctcgacgaggcgtcggcggcttgtgctgccca
aggcttcttgagatttgtcgttaggcaccacagagactggggttttggcgcgagtcagcgacgtgagaacgcatatcttgttcaataaagtatacaaaat
gatgttgagtatgtgattatggaggttcacatcgcaattggtgccgattacggttccaggtgcaactccacaccatcacagcagttgtggcgcacagagt
gccaactggcagctatggtccttgagatctacatgtacaagttcgacgatgcatcctttcattatttttgtttcgcattttaattggccggcatggaatt
tgtagaccccattgttgtcactcacacttaattcagtccgtgtcaagagcaacaaacagcataaccagttaatcaactcaattcttcttcttcttcttgt
cactcacaagtttccgtgcactcttgcatgtgctctgtcgcgtacgcgtttaaagttccatggcccacacgattgttttaatctaaccagtgtgttgaag
caatcagaatacaaaggcacaataacccggtgctatatagacggctcaagcgaaacacaccaatgttcttggtgcagttgtcagtgagtaatgagaggct
gaaaactttttgatcaggcttgtgccgtaggcacgtttgttctctttcctacagacatccgacgcgattcggacacatgtactaacagccagcttgcttt
tctttggtgaatccaattctcacaacaaacgatagtgcttcgaagttgccaaaggtaaaatacgtccttaaaacagtaatgtccaacctcgccgtgaaat
aagtaattagaagggtgaggcttccaatttggaaaccccaagtaaaactcgtatcctttttacagaattcctgtatttagagcgggtacaatttagttca
aagtgccagacttgcacatctcgtagttgatctttcattttctttgagatgtgcgctcgaatcgtaagctgccagcggatacggtactgcactt