Description :
From Genome Similarity Track
Location :
Scaffold_1499:2782- 8089
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1499-fgenesh-gene-0.060S ribosomal protein L13
Pytar_ATCC12531maker-par_contig_1499-fgenesh-gene-0.2Folate-Biopterin Transporter (FBT) family
Pytar_ATCC12531maker-par_contig_1499-fgenesh-gene-0.1Protein AATF
Pytar_ATCC12531snap_masked-par_contig_1499-abinit-gene-0.14Conserved gene of unknown function

Sequence
5307 bases(100 bases per row)
ACAGGCCGCCAAGAAGAAGTCGCGCCGCCTTCGACGCAAGGAGAAGGCTGCCGCCATCGCCCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCCGCGGGTCTGTTGCGTCCGGCCGTGCACTGCCAGACCATCAAGTACGCGTCCAAGGTGCGCGCGGGCAAGGGCTTCACGCTTGAGGAGCTCAAGGAG
GCCGGCATCACCAAAAAGCAGGCGCTGTCGATCGGTGNNNNNNNNNNNNNNNNNNNACCAACAAGTCGGTCGAGTCGCTCCAGGCCAACGTCCAGCGCCT
CAAGGCCTACAAGGCCAAGCTCGTTGTGTTCCCGCGCAAGAGCCTCAACAAGCCCAAGGCCGGCGACTCGGCTCCCGAGTTGACCAAGAACGCCGTGCAG
CACGCCGGTGCGATCTTCCCGATCACGCGCGTCGTGCGCAAGTCGGAGACGGGTGTGATCACGGACGCCATGAAGGAGGAGAGCGTCTTTGCCAAGCTCC
GTGTGGCCCGCGCCGACGCCCGCATTGCCGGCAAGCAGAAGAAGCGCCTCGCCGACAAGGCCGCGGCCGCCGAATAAGCAGTCTGTCGGACCAAGCGGAT
CTCGGGAGAAGCAAAGAGTTGTCATTAGGAACGTCTAACTCACCAAACAAAGGGCCTCAATGTGGAACTTGCAAGTTTGGGTCCAAAGGGGAAGCTGGTG
CGACCAGCAGTCTTTCTTTTGCATGTGGGGTGAGCATAGCTGATCTCCCTCAATTGTAGTACCAGTTCAGATCATTGAATGACTAACTAGACGCGGGTCT
CGCCCAGCAGTGGCGACCGTTCTGCAGCGAGCTCGACGACGTTGGAAGACGACGGCGTGGAGGCCTTGACGGCCGCGTGGGCCTTTTCAGGAAGCACGTA
GAGGAACGCAAGCACGAGCAGTTGGCACGCGGCCGACATGACTACGAGCAGCGACAGGTTGCCCCAATTGACCTGTTGCGTGACGGGATCCTGTGTGATG
CCCAGTGCCGTCACGACGACCGAGCTGAGAATGCCCGAAAGCACGCCGCCAAAGTCCATGAAGGAGAGATACAACGCATACGTGAGCCCGTGGACCTCGC
GGTTCTCTGGACAGTAATACGTCGCGACGACGAGCAGTTGGAGAAGCGCGAACTCGGCCGTGAAGGACGTGATAAACGACTCGAGTGTACCAAACGCACA
GATGGAAATGGGCAGATTTGCCACGGGTGGCGTGAGCAGCAGACGCGGGAGCCCGGCGAGCACGGAGCTCACGGTGGATGCCAAAAAGACGTGGCGCACG
TTGCGACCACTGCACACTTTGGCGTACATGATGCACGACACAAAGCGGCCGACCATGCCGGCCAGCGACGAGTACTGGAGACATTCGGGCTGGTCGCCGA
GCAGCGAAAACGTGTACTGGTACCACACGGTGCCATCGCTCGGCAAGGCACTGCAGAGACAAAAGAACACCATGGTCGGCAGCACGGGCTTCATGATTGC
CAGCTTGGCCGTGGCGTCCAGTCTGAAACCGGTCCACCTCTCCCGAATCGCCGACAGAAAGGCTGCGCAGCCCGTACGAGGCGTTTCATACTGTGGCTCC
ACCATGGGCTCGGCCGTCGCTTTGCGCGCTTCCTGGATGCCGACAGCGCACACGACGGCACTGAGCAGCGGAAACACGGCCGTGAACGAGATGATGTTTT
GCGGGGCGATCGCTTTGTTCTTGTACATGGGGATACCCACGACAAGCGCAATGATGGACGCGAGATTCTTGGCGCCGTTGGACCACGACTGCACTTTGGC
GCTGCTGCGGCTGGTTGCGTCGCCGGCCGCGAGGTCCACAAGGAAGATGCCGAGCATGATCTGGGCAAAGGCCTCGAAGATGGCATCCAACACGCGCACG
ACAAACGCCCCGGGGATCGAGCTCACGTACGCGCCCGTCACAAAGAGCGATAGCGCGGCACCAATCTCGCAGATGATGATGTAGGACTTGCGGTGGTACC
CGGCAATCGGGAAGTTGTCAGAGATGAGTCCGTAGAGCGGCTTGAGGTTCCATGGAAAGAAGCCGACCGAGTAGTAGATCGTGGTCGTGGCCGGCGCCAT
GTGGATGACCTGGAAGAGCCACTCGCCGTACGCCGTCATGGGGAACGTCATGAAGAAGGAGTGTAGAAAGTACAGTGCCAGCAGCGCGTAGGGCACGCGC
GCGAGCGGCGCGTCGGACGTCATTCTCGGACGCAGCACTTCTCGCAATGTAGCCAGAAGTGTAACACGGAGAAAGGCAATTGAGGAAGATGAGACAAAAT
AATCTGAGTGGCGACGACGGTAGAGGTGGCTACGTTCCTCCACGCTCTCCCATTGGCTGATCATTTTGTAGTTCTATTTTATTGGCTGAAATTGAGTATC
GAGATATGTGTTTGGATTGGCTGAAAATGTGCAAGGTNNNNNNNNNNACCATTGGCTGATCATTAAGTAGTTTTATTTTATTGGCTGAAATTGGGTATCG
AGATATGTGTTTGTATTGGCTGAAAATGTGCAAGGTGAGCTCTTGGAACTGCTGGACGCTGGAAACGGTGTGGACAATTGGCGCGACCACGGCGAATATA
CTCGGAAGGGGTCGAAGGCTAGCGACGATGGCGCAGGAGAAGCACTTCAATGTGGACGACGCAGAGGAGTACGATGACGGCACGCGCGCAGTGACGTACA
GCGACAATGAGCTGCATTCGGACTCGGACAATGACGCGACGACGACGCTGAGCTCCTCACGCAAGCAGCGGCTCCAGGTGGAATCGTTCAGAAAGACCAA
GCAGGCAAGCGAGCGCGCGTCGGCGCTGCGCGTTAAGAACTGGGATGCTGATGCGTTGAAAAGCGCCTCGTACGCCGGCAAAGTGGTCAAGCGCAAGGAT
GTGTCCACGGTTGACTTGGACGAAGGGATGGAGTCGCCCGACGACGAAGCGATGGCCGACTGGTCGGAAGCTGAGCCGTTTGGTGAGTCTGAGGAGGAAG
AAGAGGAGGACGACACAGCCAATGATATGGGTAGCGATGCGAGCGACAGTGACGGAGAGGATGACGACGCTGACGGCGAGCAGGATGCCGAGACGCTCAT
TCGCAGCTTCCAAAAACAAGACTCGGCTCAGCTCATGAGCTCCAAGGACACTGCCAAGCTAGTTGAAAAGGCCACCCACGTGCGCAACCAAAAGCTCATC
TGGGAGCGGTGTCTCGAGATCCAGATCTACACCAAGCGATTGCTGACGACCACGAAGGAGAGTGCAGCGGCGGTTCACGGATCGACAGAGGAGGACCAAA
AGGCCGCACTGAGCGAACAGCTCTTCTCGTGCATCGACACGGTCTCGACCCTGCAAGACAAGCTCTGCAACTCTGCCGAACTATCAGTTGAGCCCCGAGA
TCATGAAGACGACGAAAGCAAGACACGCAAGCGCTCGATTGAGGAGGTCTGGTCTCAAATTAACCTCGCCAACCATGAGGTGCTGCCGCAGTATAACGAG
ATCCTCAACACGTACTCGCGCAAGACCAACTTGGCCGGCGGCAGCCAGGCGAAAAAGTTCAAGGCCGTGAATCAAGACATTCTCGCGCAGGTCGAGTCGG
TGCTCGCGGACCCGCAGCGCGTCAAGCGGAAAGCGCACGCACCCAGGGAGGTGCCATTGACCAGCGAAGGTGTGGACTCTAGTAATGGCCACACGACCGG
CGAAGAGAACGACGACGACACCAGCGATCAGCTTGATGAAAGTATGTACGACGACTCGGATTTCTACCAGCAGCTGCTCAAGGAGTTCATTGAAAGCGGC
GGCAGCTCGCAGGACCAACTGCTGCGCCGCACGCACCGCAAGAAGAAGAAGGTCGTCAACCGCAAGGCCAGCAAAGGTCGCGTGCTGCGGTACACGGTCC
ACCCCAAGCTCGAGAACTTCATGTTCCCCGAGCCGTACCCCTCCTCCGAGATGGATGTAGACGAGCTCTTCCGGTCCATCTTTGGCCAGGCGCGACATGC
CTAAGTTTATGAGAGACTGCGAAATAGAGATCCCCTTTATGTTTTGTAAAGCGTCTTCACCCAACAGAGACGAGTCTCCTCTCTCTACAAGACATCATCT
TCATCTTCCTCTTCTTGCTGGCCACTCAGATACTCTTCACGCAAATCCTGGACCCGAGTCTCCACGGCTCCCAGTCGCGTGGCGTTGATTCCCTGGGCAC
CGAGCTTCTTGACAATGCCGACTAACTGCACAGCCTTCTCGGCAACGTGGATGACCGTGTTGGCGCGGATCTTCTTGGCTCGCGTCGTCGCGTCCAAGAT
CCGGAATTCTTCTTCGGCCAAGTCGAGCGCCGCGTCCGCTAGTACCGTGGTCGCATCCGTGAGCTCGGTGCCGCGTTCGTCAAAGCGTTCCGGAATCCTG
CCGTCCCGCAGCCGCTGGAGTTCCGCCGCGTAAGACGCGTTCTTGAAGACCTTGTGCTTGAGCTTGACCGTGTCTTTCAAGAGCTGCGTGAACTTGTCGA
TCAACTCGGCCTTGTTTTTCACTGTCGACCGCATCGTTATGGGCGCGTTCAGAATCTGAGCACGCTTGGCAATTAGCTGACCGGCGTCGCGCTCCAGGAA
CGAGAGACTCCAAAGACGCCCATAGGCCTTGCCCGCGTCCAAGCGCTCTTGCTCATTGAAATACCAGTCCCGCGTGTCCTTGTTCTTGATGAGCAGTCTA
TGCACGTTCGAAGAGAGCACTGTGAGATTCCTCAATCACAATATTAATTCAATGAAAAGACTCACCTTGCTGACCAAGTCTGGACCGCGTCGGTACCAAG
CGAGAGGCCAAACCGTTCGAGCTTGGGCGACACATCACCGTAGAATTGGATGGCGTGCTCATCAGACGTAAACTTCTCATCGAGTACCAAGCGGATAAGC
TCAACGATTTGGCCGCGATTGTCCACGAGCTTCTTGTTGTTGTCCTTTCTCGCTTTCTTCTCGAGCTGCTCAATCATTGACATGCCTCCAACACCTTTGG
TTTGTTGCTGCTCATCACCAAAGATATCATCGAGGGCACTCTCGGCGGCCGCCAGTTCCTTGGCCATTTGATCTTCGACTTTCGGTGGCGGCATTCCGGC
GTCAAGGCCTCCGTGACCAGCTCCTCCTCCACTACCAGCTCCTCCACCGATGGACGCTTTGCCAGAAGACACTGAGGAGTGTGTGAGTAACTGCAAAGCG
GGCGAACAGGAGAATACTAAGCTCACGTACCCTGCGAGATGACTTGCTGATGTTGCATCAAGATACTGAACAGCTGCTCCATAGAAATCGGCCCTGACGG
TGGGCCT