Description :
From Genome Similarity Track
Location :
Scaffold_1002:2782- 4275
Sequence
1493 bases(100 bases per row)
TCGACTTCATACTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGA
TTAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGTGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATC
TTTTCTCCTTCTTGCTCAACGCTTCGTTGTTCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGAGTAGACTTG
GCGTCCCAACCATGCACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGT
CGGCTTGAAGTGGGTCTTCTACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTAGCTTGTGGTCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGAGAACCTTTGGAACACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAAC
TGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTTGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACA
ACAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGTAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGA
GTAACCTCTCAACTGCGGCTTACGCTTACTGGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGGTCAATCCAGTAGTAGTCG
GCCTTGACTCGGTGGTAAGTTCTGACGATGCCTTGATGCCCCCCTTCGATCGAGTTGTGACAGTTATGAAGTATCTCGTCGACCATAGTTGACGGAATCA
CCAATCTCAATGAGAGGTTCGGCTCGCCGAATTCGCCCTGTCGGCATGTTTCATCTCGGCGGTATAACAGACCGTCTTCGCTGAGTACAAAGACTTTTGC
CGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCAAATTCACCTCTCAGATACGCCTTCAGATCGGCCCTCTTGAGTTCTTCATCTTGTGCCT