Description :
From Genome Similarity Track
Location :
scaffold_975:2782- 3894
Transcript NameFunction/comments
Pl_101687reverse transcriptase

Sequence
1112 bases(100 bases per row)
CAGAGAATGAGGATGGAGTGGATTGGCCGAGCCCAAGATGAGGAGAAGTGGATCGTCGACCTGAAGGCCTACCTACAAGGGGACGTGCAAGATCTAACCT
TGACTGAGGCAAAAAATTGTACTAAGATCGCAGATCGCTATGAGACGGCCGAATCAGGTTTGGTATTCTACTTTCTGCCGACCAAGTAGTCCGACGAAGA
TCGCAATCTCGTCACCAAACTGGTGGTGCCCGAACGCTACAGCATGAACACATCACTATCACTCGAGTCTAGAAGGCAACCATCAAGTCATCGGACGGAC
CTATCACAAGATCATAGCTCGCTTCCACTGGCGTGGATTGTATCAGAGTGTACAACGCTACGCGGACCAGTGTATAGATTGTGATACAGGAAATGGGTGG
CCAACGATTTATAGAGAATCGCCTGGCAACATACAGGCTACGTATCCGTTTCAGATCATTGACGTGAATCATATACCGTCACTACCGAGATCGTACAAGG
GAAACACTGAGCTGTTAATCTGGATCGCTCTTTTCACTGGTTATGTGATCGCGAAAGCTAGTGCCTCTAGAACAGCCCAGACTACCGCGGGAAATTAAGA
AGAATGCGTCTTCCGCCTGTTTGGCGCGAGCGAGACTATTCGACACGACTGCGAACCCAGTTTTATGCCTGATTTCTTCAGATCGTTCAACACGATCATG
GGACAAAGGCAACGAGCGACGATGGCATACCGACCACAAGCAAACTACACGACCGAAAGGATGGTGGTCACGTTAACACGTGCGGTGAAGATGTATGTTG
AAGATGTCGGCCAGAGAGATTGGGATGAGTACGCAGAGCGTCTCACGTTCGGTCTCAATACTGCACAAGATCGCATACGGGGAGATACCCCATTCTACCT
GCTACACGGTGGGACCCGTGATCTACACTGGAAGCAATGGTGCCATTAGGATCAACGAGGAGACGAAATCGCAAACCCCGTTAATGGCGATACCACATTC
AGAAGCAGTATCAGCAGGCACAGGAGCATGTCAACACGAAACTACACGAAGCGATCCAAGAGAGGGCAGTTTGATACAACGGCACTGTCCGTCCACACGA
GATCGAAATTGG