Description :
From Genome Similarity Track
Location :
Scaffold_160:27811- 35221
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_160-snap-gene-0.17Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_160-fgenesh-gene-0.6Endomembrane protein 70

Sequence
7410 bases(100 bases per row)
NNNNNNNNNNNNNNACGAGGAGTTTCACCCAAAGCAGCGCTTCTGGGACCTCATGGCAGCCCAGGGCTTTGCTCTTCGCGTGATCGAGGACGACGAGTAT
CACCCTCACTACCAGGCGGATGATATCGAGATCTGGGAGATCACACGAAAGGTTTAGACACGACACTAATGGAGCCTCAAGAGCTCCACAAACACACACA
CAGACACCTGCATCACCATAGGAAGACCGATGTACATGTACCAGTAGCTTTTGACAAAGTAGTTCAACCATACAATACAAAACAAACACAACTCAACCTT
ACGGCGTCGACGAGGTCCTCGACGGTGCTGTAGACGCGACCGTTGCTTGCAGCGCCAGACAGTGTAGATCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTGCAGGAAATCGCGCAGCCCCTGGGTCGACATGAGCGAGCACAGCACGTCCATCTCCTCTTCCTCT
TTCGACACGCGGGGCTGGACAACAGCCGGCGGCGTTGACGCCTTATTAGTATCCTTCTCCTTGAGCTCATCCTTTTGCTGCGCTGCCTTTCTTGGTTGCG
CGACTAATTGATCGCTTACACTGGGCGACGCGCTTGAATCTGCTGCACTCGTCCCGAAAAACCCTTCGCTAATCACACCATCGAGTCCACCGCTGTCTGC
CTGGCCATTCTGCAATGCGACGATGGTCTTCCGTGCGGATTCACGCTCCACAGCATCCTCCGAGTCGAGGGATTCCTTCAATTGGAACGCATCACCCACC
GTCAGATCGCCCGAGTTCACGAGCGCTTCCAATTGCGCATGCAATACCACAAGGTTGTCACGGTCCTCATCGTCTTCGCCTTCGACTTCATCGTCGCCAT
CAGCCGCAGTGATCAGATTCGCTTCATGCTTCTTCACTTCGTCTTCCGGGACATCCTTGTATCGCAAAACGGTCTTCACTGACGGATACATGCAACTCTG
TGGCGACGCGAGCTCGGGCGGTGACGTGACCGCGGAATTAAGACTGCCATACGAGAAGTAACTCATGTAGCTCGACCACCAACTTTCGCCTTGTACAGGC
TCACTGAGCGGCTTGGCTTCTTCGTGCTCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCACCCATTCCCAAAACATGCTCC
AGGTCACTGGTCCCTGAAAGTTCGCATCTTGCAAAACATCGACCGTTTGCTGGTAGCCGTCTTCCGAGACGGCGCTCGATGCCTCGTACAACTTCGTCAT
GATCTTGATGCAATCGTCCTTCGCGATCTCGCCGTTGCCCTCAGGGTCGTACTCGTTAAACAAGATGCGTGCCCCCAACTCCAAACGATCAATGTGCTCC
TTCGCGTGCTTGTGGCTGTGGAAATACGTCGAAGTGTAGCCGTTGTAGGCCTTGGAGCCCGCGAAAAAACCGAGCATCCCACCCACGACTGCAGCACTCG
TGGCAGCGATCACTCCAATAGGACCAGTGATGCCCACGCCCGTCCAGAACCCAACAGCAGACGCCACGCTGTATGCACCGACACTCGCACCAGCGGCAGC
NNNNNNNNNNNNNNNNNNATATGCTGACCGGCCTTCAAGCGGAAATCTCTCATCAACAGCCGCTCACTAGACTCGGAAAGCNNNNNNNNNNNNNNNNNNN
NNNNNNCCTTGTGACTTTCGCTCCGTGTGCTTTGTGCGATAATCGTAGTATTCTTTACCGATGTCCACAAGAATGGACGCAATTGTCAGCGGCGCAGCGA
CAGCGCCACCAAGTGACTTGGACGTTCTCGCAATCCCTTTCGCTAATGCAACCCCACCAGCGGCGCGGATGCCGCTATCGAGAGCGCCGTCTTTGCTTGC
ATGCACAATCGCTCTGAAGTTGCTTGCAGTGGTGTCGTCTTCCAAATGATAATCGGCAATCACGCGCTCAGCCAAAGCCACACGCTTGATTTCCAGGGCT
TTGCTCGTCTCAGCAAGCGCAATGGAGGCACCTCTAGTCAAGTCGCTCTTTTGAATGTACCCCACGCAAAGCGAATTGGAAAAGCGGATCACGGCAGACG
ACGAATGGTCTCGCCAGGATTCCACCACACCAATGCCGAATGGCGTGTTGACCCTCGACCCATCTGGGAACACCGATACCGTCTCGGGTTCTGGTTCGGA
ATGATTTTCCTCGGCTTCTTGATCATGAAAATGCTCTTTGATAGCCTCCGCAAGGTCTACACAATCGAAGAATTCGTCTTCTGCAAATGCCTCCAGTGCT
GCTGCATCGTACTCAGTTACGCACTCGTAAAACTCGTCAATCAGCTCCATGTCGCTTTCTTCTTCTTGTTGCACCGCGCGTTCAATGTCGATATCAACTG
AATCACGAGTCACCAGCGCTGTGCTTTCTTCTGGAATAGTGGCGGACACTGACGATGTGCTCTCTTTATTCGCTTTAAGCTGCAGCATCTTGGATTTCGT
CGCGCGTCGAGTGTTAATATGGTCCTCCATCAACAGCATCAAATGGTCACCCGACATGTTGCGCACCGTCTCCGCTTGGCGTCTCCGCTTCGAGCTCTCA
GAGAATTGTGACCATGCGCTCACGATCAGTGCCACACTCGCACCGACTGCGACAGCACCACCGACGACTGAGATAGTCTTCAGCCCAGACTGAGGTGCCT
TGATGCTTCGCGACGGCGCTGGAATGTCCCCAGGGATCAACTCGTCCGGATGGAGGTACATGATCTTGTCCTGTTGATTGGCACCGATGCCGACTTTGCG
CGCCACGCGGATCCGATCGGGGGCAAACAAGTTATCGTGGTTGTTCGCAATGAGACCGCCAGCTCCATCGGAAGATTGTGAACTTGCAGCACCACGACGG
ATGTTCTGCTGCCCGNNNNNNNNNNNNNNNNNNNNNNNAACTTGACGAACTGAAACGCGACGTCGCGCGTGAGATCATGCCCGAGCCGCGGTCAAACATA
TCGCGGAAAGTCGCGATGGCTTCGTCCAACGTCATGCCATTCACGGTTCCACTGCGCACAAACTCTTCCGCGAGATTCGGGGCCTTCGCTAGGTGGGCAT
CGTACTCTTTCCGCGCGACCGGATCCGACAGCACTTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAGCAGCTTGAAGATCTGCTCGGCCATC
TCTTTTTCCTGAATACTCGACGTTGCATGCGCCCATCGGTCCGGGTGCCACTTTAGCGCCAACGTGCGATACGCACTTCGAATCTCGCGTTGCGTCGCGT
TCCGAGGAATACTCAGCCGCTCGTAATAGTTCATGGTCGCATTGATCTGGATCGATGTTGACCGCTTCGCAATCGCGTCTACGTACGCGCTCATCAAGTG
CTGCAAAATCGAATTGCCTGTCAACGTCGTCGTAGCGTCGCTATCGGCATGTAGCGCGTCCATGATCTGCTGCGGATCCGCGTACTTTTGGTACTCGGAT
CCATTCTTCTTGAGAAACACGTACATGCCGCACGGTGCGTACTGGAACGTCATGTCCTTCANNNNNNNNNNNNNNNNNNNACATTGTAGTCGCGCAATTT
CTGGAACGAGTTCTGTAAAATGTTGAGACTCATCGTGATGTACGCTGACGTCGCACTCGGTACCGTTCCCGTGCCGTTCGTGGACGACAATCCCNNNNNN
NNNNGCCAGTACGTGCTGCATCCTTGCAGGCAGTAGATTCAGCAGCGTCTTGGTTGCTTTCGTGATCGTCACGAGTCGTTCCGCAGTCTTTGTGAGCATC
GCAGCCGATTGCGCAATGTTCAGGATCCCAGGGATGCAATCAAACTCGTTCACAAACGTGACCATGCGCTTCGACATGCCGAACGGCTCGAGAAACGCTG
ACAGCGACTGCGAGCTGCTGTATGGCGCACCAAAGCCAACGGCGAGCACATTCGGCAGCGTCTGAAATAGTGCATCCTGGTCTGGGTACGCTTCCAAAAG
CTTCAACATCGCTTCTCGCTTGGTCACAGCTGGCATTGCTGCCTTGCTAGCAGGTGCCGAAGAAGCTTCATTCTTATCGTCCGAGACGGCTTTGTCCTGC
TTCTTTTGCTCAAAGTCCATTTTCTCCAACTGCAGCCGGATCTTGAGCGGTAAATGCTGGTACACGAGTTCACAAAACCCAAGCTGCGCGATGCTTCCGC
CGATGGAATGACCACACAGGAACAGCATCTTCTTGGTACGCTTCGCACGGCGGTAGATAGCTTGCAGATCCAAACGCTGCGCGCGTTTCCAGAACGGCAC
GTGGATATGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCAAATCGATATTCGTACGGATCCGAGAGCGGCATCGTCGAGCTCAGCACCGTTTCCA
GGATATCGCGATGCGTCGTCNNNNNNNNNNCGTCTCCATGAGTACATAGTCCCGCTGGAATTCGAGCACGGGGAACTGCAGATCGTGCGGCAGCGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTCTTTAGTGTTGCGTTGATCATCGTT
CTTACTCTTGCCTGCGGACGCAATGGCGGCGCAGAGCACGGCNNNNNNNNNNATCGCTCTCTGTGGACACCGTGCCACACCACCACGCGCCTGCGGCCGC
CTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCTGCCATTATGGTCGTTGATTGCGGCACTACTGCTGCTGGGGAGTGCGGGCGTGTGCGT
CGTCGGCGGCATTTTGCTCGTTCGCTTCTGCCCGTTGCTCAGAATCCCGCATTTGTTCTCTTTCTCTGTGGGATTTTTGTACCGTTCAGTATTGGGTTCA
GGAGATGATACCTGCGACGTGGTTACCGGCTGCTTCCAGCTACCGGTAATTTATCGGTAGTTTGAACCAGCTTTTCAGCCAATTCAAGAGGGTAGAGGAT
GACTTGGTTGCGTTGGATTGGATGAAAAAGATGCTTATAATTTTAGAGGGATTATACAATAGTCTATTTGGAGTTTAACTACATTATCTCAAGAATCGAT
TCTCCTTATTCTTAATCGTACGAGCATACCTCGAATTGAGAGTTGTAGTATCTATTCTTGAAAGTAGAAACGGTTGCGACACATTTCTAGAGCCAAGCCC
TGATGCTGTTCAATAGGTTTCAGAGGTTTCACTCTTTGCCGTGCTTCACTTTCACAAAGCCGCAAAAAGTACGAAGGATGCTGCTAGGGGGATCTCGCGC
GAAGCTGCTGCTCATCGCGGCGGGCGCTGCGCTCCTGAGCGGCAACGCGCTCCACACTGCCGCTGCCGAGTACAAGGCGCGTGACGAGGTGCTCGTCGTC
GCCAACACGGTGCGTAACTGAATGAATGCGAGCCGCTAATTTGCTACAACGGACCGTTTTTCTTATGGCAAAGATGCGCATGGGAAACTGATTTTGCTTC
CGTGTGCGCTGCTTGTTGGTTAGATCCGACCGTATGCGAATCCGACCGAGACGTATCAGTACTACAAGCTGCCGTACTGCAAGCCGAAAGAGCGCAATTG
GGACGACCACGACCTCGGCGAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAAGGTGATCACGGACTACCATCTCTACTTTGGCGTCGACCAGACCTA
CGCGCAGCTGTGCAAGCTGCCGATGACGAAAGGGAACGTCAAGGCGTTCAAGGATGCAGTCGATGAAGATTATGAAATATCCTTTTCACGTGCTGGTGTT
GCGTTTACATGCTGTGTATTGTATTGATTACGATCGTTGTTCTGGTTACCTTGACTGCGTGCTGCTTTGTTTGCGATGCGGAATGCACTTTGAGATGTAT
GTCGACGACATTCAGCTGCAGGGCCAAGTCGGATATCTGATCCAGCAGGGCATGACACAAGTCAACTACTACCTCAACACGCACCTGCACTTTGATATCG
CGTACAACAACGAAGGACTCGATGAAAAGGGCATCAACCGAGTACGTTTTCATTGCGCGCTTGAGTGACTTACTAGCGGCTGCCAAGAATGCTCAACTGA
TTGTGTCCGTTTCTTTTTCTAGATTGTGGCCGCGAACATCTCCATGTCTTCATCGGATCCTAGCCTCGAGTATCGCTACGCGCTTTCGGATGAAAACGTC
GCGAAGAATCCCGACGCCGTGTTCACGTACTCGGTGTCGTGGCACTACCGTCCCGACTTGGACTATGACGAGCGCAATGTGCACGAAGGCGAGTTCAATG
ACGACCTGGAGCTCCACTGGATCTCGGTCATCAACTCGTTCATCCTCGTGATGATGCTCACGGCATTCCTCTCGATCGTGATGATTCGCATCCTCAAGCG
TGATTTCTCTCGGTACATGGATCTGGAGGCTGGCGATGAAAGTGGCGGTCTGGAAGACGACTCGGGCTGGAAGCTCGTGCACGCTGATGTATTCCGCATG
CCTACGAACCTGAGTCTGTTTTGCGCGTTCAACGGCGCCGGTGCGCAGCTGTTCACGATGCTCATGATCGTGCTTGTGTCGTCGCTCGTCGGTATTGTGA
AGCCCAACAAGCGTGGCGGTATGATGACAGCGTTTATCGTGCTTTACGCGCTCACGGCGAGTGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCGACAACTTGGCGGGTACGCTTTGGAATTGTGCACCCCACGCTGTCTTGTTCCTACTTATGCTAATGATGGTATATTTTGTGTGTCTGTATAGC
CAACGCTGGGTCTGGAACATCCTCTTGTCGGTGTTCATCATCCCCGGCCCATTGCTCGTGATCTTCTCTTTTTTGAACTCGGTTGCAATCTGGAACGATT
CGTCGGCGGCGCTGCCCTTCGGCACGATCATGATCGTGCTCGCGATCTTCATGCTCGTCGCACTGCCGCTCACCGTGATTGGCGGCATCGCGGGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACAAGATCCCGCGTGAGATCCCCGATGTGCCGTGGTACCGCAGCCCGTTT
ATCCTCATGCTCGCGGCTGGGTGTCTGCCGTTCAGCGCCGTGTACATTGAGCTGCACCACATCTTTGCGGCGATCTGGGGCCACTCGATCTACAAGCTTT
TCGGGATCCTCTTCCTCTCGTTCATCATGCTCGTGTTCGTGACGTCGTTCACAACGATCTCGCTCACGTACATCCAGCTGTCGTCGGAAGACCATCGCTG
GTGGTGGCGCTCGTACGTCTCGGGCGGTGTTGCGGGCTTCTTCGTGCTGCTTTACAGTATCTGGTACTACAAGAACGCCACGGCCATGACGGGGTTCTTC
CAGGCTGCGT