Description :
From Genome Similarity Track
Location :
Scaffold_98:27811- 30378
Transcript NameFunction/comments
Phyta_totarag3527MDR type half transporter
Phyta_totarag3528hypothetical protein

Sequence
2567 bases(100 bases per row)
ACACCAAGCTCCACGGCATCAGGCGAGTCCAAAATGTCAGGCTCCACTGAGAGCAGCTCactcagcttcttcatgtcgacgACCGAGTTTATCACCATAT
TGTAGATACCACCCAAGAAAAACAGCGGTGCAAAAAGGTTCGTGAGATACACAGAGATGGCAATGAATGCACCGATGTCAATTTTTCGCCCACTGTCCTC
GCTCACCACGTGCGGTACTGCCAGCGCAAGTGCCGCCAAGACGGTAACCTGAATGATGATAGCCTGGGTACCATTAAGCACACTGAGCGAGGCTTGGACG
GAAACTGAGTAGCGCTGGTACTTCTCAATCACCTTGGAATATTCTTCAATCTCGTGGCGCTCGTTGCCGAAATACTTGATGGTCTCGTAGTTCAGCAGCG
CATCAGTAGCCTTGTCATGGTACTCATTATCATGACGCATCGAGGCCTCACGGTACTTCTTACGCCAGAGCGTGATCTTGATGGTGATGTATGCATACAC
TACCAAACTGGAGAATGCTACAAAGCTCAGCCCCGCCAGCTCGAAATGCATCGCGAAAATCACGATCACCACCACAGACTCGGCCAGGGTCGGGATCAGG
TATAAGAAAACATAGGATACAACACTGTTGGCCGATTCAACTCCGCGATCCATAGAGCGCAGCACGTCAcccaacttcttctgcacATGCCAGTCGTATG
AAAGCGACTGCACATGCTCGTACGTAAGCGTAGCCAACTCAATGTACGCCgtctgcttcaccttgagGTAAATCAGCGActgcatctccttgaacagctT
CGACACGAGCGTCAGCGCACTGAAAACGGCAATATCCCAAATCGCACCTCCGACATCTTTCGCCACGAGAGCATTCGTCGCCGATGCCATAAACAACGGC
GCCGCCAGATTCGCCAATTTACTCAAAATCAGCACCAAGTAGGTACTAGCAGCACGCATCTTGTTGTTAAACCCGTGCGGCCAGAAGTACGGCTTCAAGA
TGTACACGAGCTTCACGAACGAAATGCCACGCGGCTTGGCCGGCTCCATCGGCTTGTCCGCAGCAACTTGAGGCAGAGCTTCACCCTCCGGCGTTGGTGG
AGTCCTGATTGAGTCCAGCAAGTAGCTCAAGTtgaccacctccagcaccgtgAAGATGAGCGGCAGCGAGTTGGCCACATTAGCGTCCACCAGGGCTTGT
TTCTCTTCATCGAGACGCGAAATAGCGTCCAACTTGAAAGCGTCCACCGCCAAGACACCCAGGAAGCCAAGACAAAAAATGTTCACGATCCACGTGACGA
CGCGCGTGTCAGGCCAGCGTGTCGCTAGCAGGAACAAGACACTTTTGACCACTGTGGCCCACACGGGGAGTCCCCAGAAGCGCCACTGGGTCtgctgcac
gtccagcagccaaCCCAACCGGGTGAAAGCCGACCCCCCGaggctcaagctgcagacgaagaggagactGGCCAAGTCCCAGgccaggagcagcagtaaA
TTGAACTGCAGACACAGCATTTGACGTTGCGCCGACTTGTGTCTTCGTTTGGGGGACAGCGGGTCGTCATTGCGGCTGTCGTCCGCATCGTCGTCTCGCC
AGCGGGAGtgcgcgttcttcttctctctgGCGTCCGGACGATTCGTCGCATTACCCAGTAAGGGCGTGGCCTCCTTCGGGGAGTTTTGCGTCATGGCTGA
ACGCGGACGGGCGCGTTGCTTGTGCTTTTGAGCCGGCAAGTTCGAAACTGAAGCACAGGGCGAGTCTGACGTTGCACGGCTCGGGTTTCAAGCGATCTGA
TTGGACGAGAGAAACGCCGTGATGACGTACTCCAGAGGAATGATGGTCACTCATCAAGTTGCCTTTGTACGCAAGCACATGCTCAAAAGGAATTTAGTGC
CGCCATTTACAAGGAGGTTCGTCGAGCTTCAATATGCAGCAAGGAAAACGAATGCCGAATTAAATAAGGGGCTTTGAATCGTGGCAATGTCGATGCTCAC
TTCGTCTACCGTACTGTAGCACTTTCCTATTCGATGACAGTGACTCGACCGGAACTGAATTGTACCAATTACGCAGATCCTTCCTTGACGGCTTCCAGAC
CGCGAGCCTTAAACGGTCAGGTCTTCGATCCCcgatgagctgcagcgctcgatACGCGTAATATCCCAGTCTCGGTCATCCGTCGGCGAAAAAGTGTGca
ccgctgctgcaagcgTTTCCGGTGAAAAAACACTGGTAGCGGTGGTAGGGGACATGACCGGCGAGCCGTCTGAGATCGGGACCCCGCGACTGGCATCCAC
TTCGAGGTTATGCTGCGGGTGCTTACTCACGAGCTTGTCTAATGTCTGTCGCATCAGTCGGACGGCGGCTTCTTTTGTGGAGTCGCTGGAACCTCGCTCT
TGTAGGATACGAAGAACGTTTTCATGGCTCTGAATAGAGATCAGTAGTGCCTCCGAGAAGGAAGCCATGTCGATATCTCCCAGATCCAAGTCTTCAACAG
GTGTCGCTACGAAGTTTGCCAGATAGACGTCGTGAAGGACGAGCACATCTGCAAGTTCCGGGTACTG