Description :
From Genome Similarity Track
Location :
scaffold_48:278094- 292550
Transcript NameFunction/comments
g7493.t1 conserved hypothetical protein
g7494.t1 hypothetical protein PHYSODRAFT_298682
g7495.t1 hypothetical protein PHYSODRAFT_543923
g7496.t1 hypothetical protein PHYSODRAFT_496973
g7497.t1hypothetical protein

Sequence
14456 bases(100 bases per row)
TTAAAATAAGCACCGGAATGGCAGCCTTGCGTGCAAAATTGCTGATCCGCCTGCGATGCTGCAGACCACCACTATATTTACCATGGACGCCAGCGGCACC
TCCCACCTGTGAGGCGATTTTTAGAGATGGAAACCTCCAGAACTGCGGTCTATCTCCGGACATGGTTCTTGTCCGACAACTTGGCTTGCAGAAGTAGTAG
ATGGCTCGTCGGTTGATGTCCGTTTCCTGAGCTCATTCTTGATTCGGCTTGAGCGAGTGCGCGAGGAAGAACAGACTGAGACCAAGCGACTGGCAGCATG
CGCTATCGGGAGGGACTCGCATTGCTCCTGAGCACGACGATGGGGTGGAGCCCGGTGCTTGGAGCAGCCACGTGGCCGTCCACCTGCTCGGATTCAGCGA
TGTCAGTGTGGCAAGCCACGTGTCCCGCGCGCACGGCGAACAACACCAACTACGTGTCGCCAACCGGCATGACTTCCGCTGAGATCAACGCCGACGAGGC
GAATGCCCTTGTAGCGTACAAGACGGCACGTCAGAGTGCTCTCAAGTTGAGCGCTGTTGCAGGAAATTCTGCAATGTCGGGAATGCGCCAGAAGAGCGAG
AGCTGGTACAAGAAATCGTTGGCGAGCTTTACCACCTACATCTGCGTCCAGTCCTCGACCGACGCAGAGCTGGAGCGCTGCGTGGACCCCTCAAGCAGTG
ATGCTATGCGCGACATCAATGGCAAATGCGTTGTCATGCTAGACGCTGACTCCTGCAACAGCAAGGACAAGTGCGAGCGCAGGAGCAATTGCAAGTGGGA
CGACGTCGTTCCTAATGGAAAGGAAGCCCGCCGTCAGATCTTCACGGACGCTGATGTTACTGCTGCGACCAAGTGGATGTCAACGGGGTACCCTAGTTCC
TTGGCCCCTTTTGTGGCTCCTGGCACCGTCATGGGTGTGCTTACAGCGTTGAGCTGCATTGGCTTCGTAGTGCTCCGATGCGTATTCAACCGCTGTGGTG
GTCGTGAGCCCAACGAGAAAGGCTACTCGCGCTGTGACGTCCTCGTCCCGACGCTCACTTTCTTGATCTGTTCGCTGGCAGTCTTCATCTGCATGGTCAT
CACAGCAGCACTCAATACAAGCATCTCGGATGGCGTTGAAGATGTTCTGTACTCGCTAAAGGCTACCTTAGAGAACGCCAACATCTTTGTGGCCAATTTG
CTGACGCCCCTGAACGACGCCACCGCTGAACTTACTGTAGCGTCGAAGGCGGTGAACGCTCAGCTGAAGAACTCGGACTGGATCGTGAATGACGGCGCCA
CGCTCAGGCAGATGATTGCGGATTTCGGTAGCATCTATTACAACCACGGCACATTCCCGACCCTGACCTGCGATCCTGCGACGAGCGAGACATTCTGCAT
GGCATGCCCCGACCGAGTTTGCGGCTCCCCCGTCACGTTCTTCGTCAACAACACCGCAGCCGCAATCACGGCAAGCAGCGACATTGTAGGAGACGCGGTG
GGCTTGCTTCTAAGCTCACTTGTGAACGGAAGCGCTGCACTCGACACGACTCTGCGTACGGCGAAACGGGATATTGCGGTTTTGGGCGCAGCTACAAACA
GCTCCATGGATGTCGTGGGCGTGCTTACCAGTACTTTCAACGACCTATCATTCTCGCGCAGCGCACTCGTGGTGTGCGTGTTCCTGTTCGGCATGATCTC
GTCGATCCTGGGGATCATTGCCATCGTAAAGAACGCCTGCACTGCTAAGACGACCCAATGGGTGCATCTGCTTCACGTAAGCTGGGCGCTGGGTGTGCTT
GTGTGCGTGTTAAGCTTTGTGCTTTCGGCATCCCTCCTTGCAGTCGGAGCTGTGTGGTATGACTCGTGCGAGTACATGAAGCTACTCCACGAGGACATGT
CCCCGTACGCATCGACGCAGCTATCTGCGATGGCGAATGCTTGCTTCAACGGCAGTAATGTGCTCACACCGCTTGGTCTCGATGCTCCTCTGACCTTCTC
CTGCAATGTGGAAGACGAGTATAAGGTCGTGAAGACAGCGGACACCACGAGCGTCGGAACAGTCATCTCGAAGTACGGCGAGATCGTGTCCAACTTCGAC
CTCACCGATTTTAACTTCAACTCGACGCGCTCGAGGAACTTCGTGTCCAAGCTTGCCACTGCAGCGGAGGCCGCGAAAAAGAAGCCGGCCGTGAAATTCA
CACAGGAAAACATCCTGACTCCCTGGCTGGCATACAACGAGCTGGCCACATCGTACGGCTGTGTCAACAAGACCACGGAGGAGCTCCCTGTGTGCTACAT
GACGGGTCTGTGCGAGTCCGACACGTCGGCCAAGACGACAACGCAAGCCGCTTGCCAGCTTGCATTCTACGAGGCGTACGAGTACATGTTGGCCTTCGAC
AAGGCGAGCACGATGCTGGACGAGATGCGCGAGACTCTTCTGGGAGACACGGGCAAAACCTTCCCAGACCAGTGGAATTACTCCATGTCAATCTCCGAGT
TCGCCACTACGTACTTCACCAAGATTACTGCTCTGAAGACCGGCCCGCTGCTGACGATGCTGGGGGAGAAGGGAACGGTGCGCAGCCTCATGACGTCCGT
GGAGCGGGCACGCTGCTCGGGCGACTGCGCGTGGGCCAACCTGTCCTTCGACGCCATCAACGAGTCGCTCTGTCAGAACGTGCTGGGCACGACACTGGCC
ATCTCGTTGTGCGCGCTGTTCCTGAGTCTGTTCCTGCTGCCGCTCATCCTCTCAGCAATCCTCCTGCAGAAGCGTCTGCGCGGCGTGGCCAAGGGCACGT
ACGACCAGCTGGAGTTGCGTTTGCAGGAGCTGGAGCGCCGCGCCAAGCAGCAGAAGCAGGAGTCCGAGGGTCTGTCACCCAACGGCGAAAGCTCCAAGCC
CACGAGCGGCCTCAGTGCGCTCGGCGGGCTCTTCAAGGGCAAGAAGGTGCAGCAGCCGACGGGCTCTCCGTAACGCGGTTTATTAGCCTCCTTTTCTATA
AGCCAGCGCCGTGCTTGCTCAACGGAAGGTGAGCACACCAGCGCAGGACCTCGACTATTAAAATACAAGTAGCATTTGCATAAGTCAGCAGTTTGCCATT
TGCGAAAAAGTATCTTGCCTCTTCAACTTGCTCTGGACGCTGTTTCAGCCAATCAAAATCGATGCAGTTCTATGTTGAACCGCTGCATTTCTACCAACCA
GTGGCCAGTTCCAGTTCAGTATCACATTTCCACAGGTCATCGATGGCAGCTCGCGACGTAGTGGTGCTGGGTGGGGGCATCTCGGGCCTGACGCTGGCCT
ACTTCCTGCGCCAGGCGCTGCCCAAGGCCGCAGCCGATGCCACGCGTATCCGCGTGCTGGACGCCGGCCCCGTCCCTGGCGGGTGGGTGCACACGGCCAA
GCGCGACGGGTTCCTGTTCGAGGAAGGTCCAAGAGGTTTCCGACCCTCGCGCAATGGCGCCGAGATGCTGAGATTGGTGGAACAGCTGCAGCTGCAGAGT
CGCATGCAGGCCGTGGACCCGGCGGCACACGCGCGATTCATCCTGCGCCACGGGAAGGTGGAGAAGGTGCCTGGATCGCTACTGGAGGCGCTCCGGTGGC
CGCTGTCGCTGCCTGTGGCGCGCGCGGCGCTGCACGAGCTGTTCGTTAAACCAGGGACAGCAGAGGACGAGTCTGTGTACCAGTTTATGGCCAGGAGGTT
CAGTCCCTTAGTGGCTGAACGGCTGCTGGACCCCGTGGCGTCGGGAATCTTCGGTGGAGACATCAGGAAGCTCTCGATGCGCTCGTGCTTCGCCATGCTT
GTGGATATGGAGAGGAAGCACGGGTCGGTGGTCAAGGGGATGCTGTTTGGTGGCACTGGCGACGACACGCTGCTGGATGGCACCAACAAGTCGGACTTTG
TCAAGAAGCATGATAAATCGGTCAGTGTGAGCTTCACGGACGGCATGAGTACACTGATGGATGCACTGGCAGACAGTATTGAGAACGACCCGATGGCGGA
GCTGCAGCTGAACACGAAGGTGACGAGACTAGCGGTCCACGGTCTCGACAACGCATCGTCAAAGGCCCCCAGCTTCGTGGTGGAGAGCAAGGATCCCACG
TCCGGGGAGTATCGGGAGCCGATTAAGGCCTCGCACGTGTTTTCGACCATCCCGGCATGCTATTTAGCCCCGGCTGTGAAGGACACGGCGCCTGGATTGG
CAGAAGCGTTGAGCGAGATCAAGTTTGTAGACATGGGCATGGTGCACGTCGGATACAACGACAAGGTGCTGTCTACCGAGGGCTTTGGGTATCTGATCCC
AACTGCAGAGCGTGAAAAAATACTTGGTGTTGTGTTCGACTCCAACACTTTCCCTGTGCAGAACGCTGAAGGCAAGACGCAGACGCGACTGAGTGTCATG
AGCGGTGGCGCGCACTTCCGTGAAGTGGCGTCGCTGCCGGAAGGAGAACTGGAGCGCAATGCCCTGGATGCCCTCAATAGACATCTCGGTATCACGTGTG
AGCCTGACTACGTGCGTGCTATGACGATTAAGAACGGAATCCCGCAGTACCACGTGGGCTTTGCTCAGACGTTGCAGCGTATTGAGAAGCAGGCGGCGCG
CAGCGCACCGGGTCTGTTTCTGGGTGGCAACAGCTTCTACGGCATTGGTCTCGCTGACTGCGTGACCCACTCCAAGCAGCTCGCGCTCAAGTTTGCCAAG
ATCGCGTCGTCTTGAGAGAATAGAGCTACGAGGCAGTTGGTGCATGTGCACATTTTGGTGTCTGAAGAGTGCGTGCGTAGTGTGCGATGGTGCGTGAAGT
ATCTTCCACACTGCAGTGAAAATGGGCAAATTGCTACCGTTCTCTTTCGTGCCGGTTTTCGAGTTCTTCGTATTTATTTGGGCGGGCGTGTTGTGCAGAA
ACGGCTTTTCGGGAGCGACTTCTTCAGCTCGTCGATCTTTCGGAGCTGTTGCGTGCTGCAGCCAATATGTCGCGGACTGCGCCATCTCGAGCGCTTGATC
CTGTCTACGGTAGGCTTGGCGTCTTCGTTGTGGACATCTCGTGGGTCGCCTTACAAACTGTTCACTGTCCGCTGCAGATACGGTGTACACGGTCTCCAAT
TCAGGCGGCTCATTCCGCAAGGGTGTCTACCGAGCATCTTCGAAGCCTGCTAGCACTGTGAGCTCCATCGGTAACCAGAACCCGGCGGAGGGTAATGAAC
TCGTAAGCGGCAGCCAGCGGGTCAAGTTCCATCGGAGACCAGTGCTGCCGCACCTGCAAACGGAGCCACCGGAAGTTTTACTTGCTCCGGTATATGCCGC
CTCGGCACCGCCAGTCAAGCATCGAGATACGAAATTGTCAACACCCTCCCATGTTGCTGCCGATGTAGTTAATGGAAATACTCGGTCAGTGGGTATCCAG
ACTGTTTATCGCGAGTCGGAGGCGCAGACAGACCCGTACACACCAGACTACACCGTTCAAAAGACAGCTACTGGTTTAGCACCCGAGATCGCCACGCTTG
CGGGGCTAAGCCATGCACGTGGTCAACTACCAGTTGGGCAGGCGGAGCTGGAACTTATGGAGCGCAACCGCAAGAAGAGAGCTTTCGAGGCGTCGCTTCC
CCCCATGACCGACGAAGCGAGCTTTCTGTTGCGCAAGGCAATGCTGGAAGCACAAGAAACCCGTGAATGGGCATTCCGCGAGGCGGAGATCGATGCTTTC
CACGATCAGCGTGTTGTACTACTTGAGCAAGCACTTGCGGAGCGCGAGAAAGAGACCGCATTTCTTTCGGAGCAACGGCTTGAAGCGCTTCGTCAGCGGC
TGCTACATGAAAAAGAAAATGCGCTTGAAAGTATTCAACAAGAACGCGTGACAGCTCTGCGAAAGTTGACGAAGAAACGAGCTCAGAGACAGCAAGAGCG
CGGGTTTGGCGCATCACGTCCGGAGAGAGGCCGCGACATCATTGCCGAGTACGCGAACTTCGGCTCGCAAGTATATGCCCCTGTCACCCGAGATGGGAAG
GCTGGCAAAATCGAGGTTCGTGAATTGGGCATCGGGAAGGCGCAGTTTTTGCAGCTTGATGCTTTACGCGAGCTTGAGAGTGCTTTACCTGCGCGGATGT
TACTTCCTGCTGCTGGCAAGTACAAACCCCGTGAGAAGAGTGGCCACACTGCCAAGGAAAGGAAGCAAGCAGCTATAGAAGCCCACCTCCTGAAGATGGA
ATCGATCATCAAGAAAAACAAGGAACAGAAGGAAAGTACCAGTGCGGGTGATACTACCCCTGGAGCTCATAACAATGCTCGCCTGAATGCTGCTAGCCCG
CTTTCACGACGAGCGAGTCAGAGACAACCACTAGTACGTCCACCCACACCTGACTACGCAGCGGGTCATACGGCCGATTCGCAAGAGAACGAAGTGGAGG
ATGCAGTACGCTTACTGCAGAAATTGCTGCGCGGCCGTGCTGTCCAAAATATGATGTTCGAGGGTAAGGAGAGGCGTGCCGAGCTCATTGCAGAGCTGCG
TGCAGCCGACGAGCAACTAGCTCTGCAGCACCGCCATGAATTCGCACTCGCGCAAGGTTCTGGCAACGAGGCAATCGACCGTGTTGCAGACGCAGCAAAA
ACCCGCGTGGAGGGCGAAGTGGTTTCTGAAATGCTCGACTTCTTGTCGAAAGAGCTCTATCGATCTCGTGAGGTGGCTAAAATGCGTGCTTTCGTGGCCA
AGGCAGCTGAACAGCGTCACGTGCGCGAGGTAGAGGAAGGCGGGCGACGACAAGCTGAAGACCTCTTACGTGAACGGGAAGATGAAGTATTCCGACGGGT
TATGCAGGTGCATCAAGAAACATCTCGCGACTTCGTTGACGACATGCTGGAGGATGTAGCTCTGGAACAATCTCATTCCCAAGCGCTGCAGGAGCTACAC
GTACGCAGCGCTGGTGTCGATGGACTGGTGCTTCAGCTGGAGAGTGAACTGGACAGCGATGAAAATATTGTGCGTGAGCTAGTGGCAAGCTTCTTGCTAC
CACAAGTCCACAGACAGCACGTACGCCGTCAAGTTACTCAGGAACAGAGAAAATATGTGACGGCAGCCCACGCTTTACTAACAGAGATGGTTACCGGAAT
GAGTCAACCGAAACCCAATTCCAGTAGCAACGAGGCAACAGAAGACATTCTTTGACACATGAAGGAATATAAGGCTTATTGAGGCGCTAGCCAACATGGT
GACTTATCCTTGATGCACAAGCAATAATGTCTTACTCGTTGCGTACTCGGATTTCACAGCTAACGGGTCAATTCACGTGATAGCTACTTGCCGCTCGCAC
CCCCGGCAGAAATACCGGTGGTGCCACTTCCTGCAGACTTGAGGAATGCATCGAGATGCTGTCCTTGATACTTGAGAAAGTCTAGCTCCTCTTTGAACTT
CTTCTCCTGCAAAGCTTTGCGCTCGGCCGCTCGTTTCTCAATAACCTCGAGTTTGTTGGTTAGCTCCGCCACTTTGCTTTCGCTCTCGTCCTTGTCACGC
TGAAGGCTGGCGATCTGCTCTGCCAGGTCACCCATGCCGTCTTCGGCCTGCAATTGTTTTCGGACGCCAAAGGTCAAACTCGAGTCGTACAGTGTCTTGT
AGGCATCCGTAGTGAGTCGAAGCTCATCACGAACGCGTAGAAGCAACAGTCCTCGCTCGGGGCAGTTGAGTGTCACCTCACGAATAAGCTCATCGAAAGC
TTGCGAGTACAGATCCTCCCGGACGGGACAAATACCGCTTTCACGGGCTTGTCGCTGTAGTAGCTTGGCATCAAGTGCCTCCTGCAATTTCAGCACATCG
AAGCGAGTCGAGGGCACGCTGGACGCGTACCGAAGCCAGAAACCTGAATTCTCCTCGGACCACATCCTGAAAACAGCAGAAGCGATGGTTTAGCACATGT
CATTGCAAGTGATCGGGTGGTGATAACGGTGACGCACTGGGGCGGTAAGACAGCATTTAGGATATCCTCGACCTTTGCAACACCATCGGAGCTTTTGCCA
TTAACTGCCCCACTCGACTCCGCGGCTGCTGCCACTACAGTTGCTGCGGTGATGGAATTCGAGGAACCTGCGTTGGCAGCACCCGGCGTCCTCTTCGGTG
GGTCTAGCGTTTCGCCCGTGAAGATCGGCTCGCCATATTGCACGAGGGATTCTGGAGGTGTCGGTGTTGACATCTTGCTCGTACAAATGCTTGGTGTTTC
TCCAATTCACGTCTGCTAGCAACCGTCGCGTCCGTTCACGAACTCAACTTATCAAGACTCTGCAAACGCACCCCATCGTTATTTGCTTTTCTGCCTACAA
CTTCCTAGTGACGCTGGTTAGATTTCGCAGCTACAAGCTCCTGCTTCTCCTGACGCTTGCGCTCCGAGAGTTCTTTGGTTAGCTGCTCTGGGCTCTTGTA
ATTGTCTTTGGCACCAACTTTGCGCAGCCACTTGCTACTGTTGGTCTGTCGTGCTGCCTCCAACGCTGCAAACTTCATCGAACCAACACGAATGAATCAG
TAAAGTTCAAGACAGGATGGCATCATTCTCACGCACGTGCTCTTTGCGAAGAGTCTTGGTGAGCTCGATCGACTGGTTCCAAGCCTTGACGTCACACAGG
TCTGGGTGATTGGGTAGCTCCTCTGTGCACTTAGCAATACCCTGCAAATCAGAGAGCAGGCACGTCAATAATCCTGCGGACACTTAAGACAGTTCCCCAA
CTGATAGCCATACTTTCATCACGCGCTCGTCGCCGAAGGCTTCTCCTATGTACTCGTCCTTCAGAGCCACCTCCAGGATGCCAGTGTTGAAGCGGTTTGA
TTTAGGCTTCAGTGTTGGATTCTTCTGGGGTAACTTTTCGGCACGGAAGTTGTACGCGAACATGTGGGCACGATTTCTCTACAAACGCCACAGTAAAGTG
TAGCTTCAGGAAGGAGAGGGCGATCCACTCATTTCTCAAAACGAAGCGTACCTCAGCATTAACATTAGTTCTCTTGTAACACTTCCCAGTCATCTGCATG
TTGTCCCAGTTCGAAGTAGAAGTCTCCCATTGTGGGGTCTCCGCCGAAAGAATGCGCGAGCGAAGCATTTCAACGACCTCCAACTTTGCCGCCGCTTTGT
CGGGCGCGGTATCAACTGGGCAGAATACCCGTTCTTCAAAAGAGTAGTTGATGGGTGCATCCTTTCCACCAATACGCTTTTTCGCATGCATGACAGTAGT
GCTTGATGGAGGACTGCCAGTCGCGAGTGATGAGGTGCGCGTGGTGCTTGCGGCAGATTTCATTGCCTTCTTCTTCTTCGACCACTGAGAGTCCCCGCTT
TGGTCTCTTTGATGCACACGCCCAAACAAACATCGTCGAGAATATAGACCACGCATCATAAGAGACAATGCAGGGATCTATTACCGTCGACAAGTGTGAA
TCGATCCGCTATTAATTGATCTGGTCAGTGCATTGAGAACACGTGAGAGCTTGTCTTACCTGCAGATACTCTCCACATCTCAAGCCGACTCGGTTGCAGC
AGCTGAAGCGGTTTGAACTTGCTGGGCCTGCCGGATACTATTGCGCTCGGCTTGAAGGTGGCGACACAAACTCTCGAGCTTCTTAAGCTTCTCCTGCAGC
TTCAGCGTTTCCTCTCCAGTTGTCACCTTCTCCTGGATAGAGGCAATCGCGCCGCTGTCATACGCAGCACACTTTTTCCGAAGAGCAAGGTTCTCCTTCT
CCAGCTTCTTGGTCGTTTTTGCCATTTTGTCCATTTCCTCACGGAATGTCGTGAACATCTGGTTACTTTTTGTCAGTGTCTCCTGCACGACGTCGAACTT
TTCAGAGTAGGAGTTCAGCTGCGCCTGTAGCTGAACCTCGCGATCGGAAAACTCCTTGGCCTTGTCGAGGGTAATCTTAACCTTTTCTGCCTCGCGTGAA
GTCAGCTCTACCTGGTGCTGCAGCTTTGTTTCCGCAAGCTGCACTGTCAGATCCTTAGCCTCGAGCTGCCGCTGGAAGTGCTCTTCTCGAGCAGTATACT
GTTCAAGGAACGTCTTCAGTTTCTGCTGGAGGCTACAAATATCATGCACATCCAGGGTAGGCAAACGTCAGTTAGAGTGTTGCGTCACTGGTTGGGATAA
GGAACTTGGTCACATACTTTTCATTTTCCTTCAATGAGGCCACGTAGTCCTTGCTCTGCTGATCCATTTTCAGGCTCACTTCTTCGATTGTCTTCTGAAA
CTGAGCCGACAACTCACGTCTGCAATCCCGACATGGACCAAACACGCAACGGTTAAAAAATAATTCAATAAGAAGTCCCCAGTCACATCGCACCCACCTC
TTCTGGTCCTCTTCATCGGCAATACGACGGCTTTCACTCTGGATACAACAAATGATGGTGAGCTCGTTATAACGCTGGAACAAGAGCTAGAAATCTCCTC
ACCACAATGAGCTTGTTCTGCTTCTGCAGCTCCCTGCAGAGCTGCTCCAGCTTGGTCTTGGACGTATTCGTCTTCAACAGCTCCGTGCTCACTACACAAC
ATCCCGAGACTCATCAGCACAGGGAGGTACTTCACGATCTCTTTGCAGCATTCACCTGCGCTCTTGCGTTGCTTCAGCAGAATGCACTTGGCATTCAGCT
CGCCAATCTTTTTCTGCAGCAGACCCAGTTGTTCACCCTGCAAATTCTACACACGTCAGTCTCCACCTCTTCCGCCCCAACAACTGCCTAAACACGCACC
GCCTGGTTGAGACTGTTGACAAGCTCCACCACCTTCTGCTCCGCCGGCATTTCCTTGTCCTCCTTCACAGCCTCCGCCTTCTCCTTGAGCTGCGTCAGCA
GCGTCTCGTCCTGGTAAATTCCTGTCACAAACCGTACTTTTCAGTATTTTATCTCTCGAAACTCGCGCTTTTTCGTCGCACCCGTGAGCTCGATGGGCGC
CTCGAGGTTCTCGTCGCCGCCCACTTCGATCTCCGCGATTTTTCCGGCCAGCAGCTCCCGCAGCGCGTCCTCGCGATTGGCTTTGGTGTTGCGCTTGCTG
TGCGCGTGGTGGCGCCCGGGAGACGCTGCGGACGGTGAGCGCTTTAACTCTCCGCCCTTGCTGGACGGTCGCTTGCTCTTGTGCTTGAGGCTTTTGGTCT
CGCGCCCCAGCTGCTTGAGCTCCAGACTCGGGTTCTCCATCTCGTGCGTCTGCTCGTCCGACATCTTTTTCGCGTTTGGGTGGCGCGCTGAGGTTTTGTC
TAGTTCGATCTAGCGTACACTATATGTACACAAAATTACCTATACAAAACGCGAGTGGGGGTTTGAAGGATTATCATGTTGATGAAGTCAACCGCACTAC
GACCATCTTGAGGATATCGAGTACCGCAGCAGCGTTTCCCGCCAGTGCAGACACTTCGACATATATCACGTTGTGCTCACTGCACCACGTGCGAGCTGCT
GCTTGCTCCCTTTGGTCCAATTGATTAACGCAGTCGCTCTTGTTGCCGACCATCAACACGGGCAGTGCCTGCGTAGATTGCGTCTCGATGGCTTCGCCCG
CCGCAATCTCTCGATGAGCGACGTCGAGGTACTTCGGCAACGCGCGCCACGAAGCTGGCGTCTGCAAACTAAAAACCAGCACGATCGCTCGAACGCTGCG
AAAATAGCGCGCGAAGATGTTCGGCCCCGCGAAGCTCTGCGGCGGCACGTCCCACAGCTGACGAACTCTCCGTTAACTCAAGGCCAGATCATCCCAAGCA
TCAAACAAGGTGACGCACTTCGAAAACTACCGGTTCGTGTCCCTCGAATCGAAGCAGCTTGGCACCTACGTTGGCTACACGGTGCAATGCCGTAATGTGA
ATGAGTTCACGCAACAGCCATATGACTCGCAGCCTCGCTTGCTCACCCGTGGTGGACGGCGTGTATTCCCCATCGAGCTGGGTCCCTATCAAACGCCTGA
ACAGCGTCGTCTTGCCCACTGCCGCCTCGCCCAGCACGACCACCTTCAGCTTGTCCAAGGTCAGTGGATCCGAGCCTTTATCTTGCACTGCGGACGTGTG
CCTTCGCCTGCTGCTGGACGCTAAGACCAGCACATCATTAGTCGCTGGCAGCTTGAAAGTCGCCCGCTCGCCTTCGGACAGCGCTATACATGCATTACGC
CGCCCACGGTAGCCAAGGGCCCTTGCCTTACCTCGGGCGCCCATGCGCTGCGTCGTTTGCCAACCGAACTGCGGTCGCCGTCGGACAAGTCCCATACCGC
TACTGTATAAAGGTCAAACTCCTGGTATAATCTATACCGCTATACAAGTAAAACGTATATCCTTGCATAACCGATTGCGATGAAAGTAAATTCAATATCG
AAATTCGACCTTGAGAAGTAGTTTCTTCTTCACTACGATGCTACTGACGTATGGTCCACCATGCCGTAATCGAGATGTATCACAGTACGTCCGCTTGGTC
CGCCGTCGGATAAGGCAAATGGCTGCGGATGTGCTTCGGTCCAGAGACCCTGGCACGCTGCACTCACTCTACGATTCTCTTGTGCGCGCGCAGGCGACCG
ACGCAATCTCTCTTCAACGCTAGCAATGGACTCCGTGGACGAGTTCAAGCTGTTCGCAGCGCTCTTCATCTGGGCGCTGGGACTGCTGGGCGGCATCGCG
CCGCTGCTGAGCAGCCAGCGCGTCAGCAAGCGCGCCAGCAGCGTGCTCAACATGGTGGCGGCCGGCATCTTCCTCGCCAGCTCGTGCATGCACTTGCTGC
CGGACGCGCAGAACAACGAGGCGCTCAACGAGTGGGGATGCGAGCACACAGCCGAGGTCTTCCTCGCCGTCCGGACGCACTACGACGGCGGCAACAAGCG
TTGCTTCAAGTGGGCCAACTTCTTTTACGGCTGCGGCTTCCTCATGGTGCTGCTCATCGAGGTGCTGGCGCACACGCTGCAGCGCCACTACGGCAAAGTG
CACGGCCACGGCCATGCGCACGGCACCGATCAAGAGCGTGACGCGCTGCTAGCCATCGAGGTCACCCGTGCTGCCGAGCTGGACAACCTGGCCACTGCCA
ACGAACACTCGCACGGACCCGCTCACGGACACTCGCACGGGCAACTGGAGACGGGAGACTATGGCACTCAAGCAGACGAACTCGCTGTCCAAGGCGAAGA
CGGAAAGGAGGCGCCGCACTCGCACATTCACGGCATCGTGAAAGGCAACCCTATTTTGGCACTCGTGGTGTTCATCGCGCTGTCTTTCCACTCAGTCATG
GAAGGCATGGGCATGGGCGCCTCAAGCACGGCTGCGTGGGATATCCTCGTCGCAATCTTAGCTCACAAGTCGCTGGCCGCGTTCGCGCTGGCACTCGAGT
TCGTGCACCACAACGTCTCACAGAAGCAGCTTCTCTCGTCCGTGGCCATCTTCTCGCTCATGACGCCTACGGGCATCCTGTTCGGTCGGTTGCTGGTGGA
TACAAACCACGCCACACCTGCTGCTGGTGTATGTGCCGCGTTCGCTGGTGGCACCTTCCTCTTCGTCGCCATCATGGAGATCATCCCGCAGGAACTGCAG
GACCCACGATACCAGATCGAGAAGTGCTCTGCTCTGCTCGCCGGCTACGGCGCCATGGGCGTGCTCTCCCTCTGGACGTAAAAACACTTTTGACTCATGT
ACAAGTATTCTCGAAGATAAACAAGAGCGTCAAACGTCAGTAAGGGCATTCAAGAGCCCGATTCGCCTAGTGCGAACGTCAATTCAGAATTCACTGATAA
ACGTTAGTAAAAAAGTTAATGAGAGAAAAAAACTTACTCAAGTAGCTAAACCACGCCCAAAAACGTCGAGGGCTTCTCTTCTCTCTCAATCTGGTAGCAT
GTGGGTTGAACGAACCGCTGCTACTCCACACCACCATCGGCTCCAATGCAGCCAGCGGATACAGCCATCCAGCAATCCTTGAGTTCGCATCCAGCGTTGC
CTCTGCTTATCTGCCGTACTTCTGGAACTCCCACTCGCGGTTGTCCAGCGGGCACACCTGGCGGGTCTTGAGCCACCTCGAAATACAGTGGAAGTGGAAG
GCGTGATCTGCAACAATAAAAATCACAATACGCCATTAGCAAATAATCCTCTCAATCCCAACCCCAGGCCTCCGACGTACTGCAGACACCCCAGGCCACC
GTGCACTCCTCGCTGGTGGCCGACGCCTGGTTGGCCTGGCACTCGATGCACAGGTCCATGATGTGGTTACGGCAGATGGCGCAGTTGTCCACCACGATGT
CTAGAAAATTAAAACAACAATTAATTATCAAAGCCCCAGTAAAGATCTCGGCGTGTTTGCGGCGGACGCACCCCAGGACCACAGCGCCACGGCGTTCCAC
TTCTTGATCTCGAAGCGCTTCTCCTCGCTTGCGTTTGCCGCCGGCGCCACGTCCGCCGTCACCTCGCTCTTCATCTCCTCATCCATCGTGCTGCACTTGC
TCGAGCTCTCGACGCCGGGTTGACCGATAGATAGTGAATGGTTTCTTCCTCTCGAA