Description :
From Genome Similarity Track
Location :
Scaffold_2755:278- 2285
Transcript NameFunction/comments
Phyag_g12775hypothetical protein PHYSODRAFT_284961

Sequence
2007 bases(100 bases per row)
CGTTGGCTCATTCGTGACGGTGAGTCATCTTGCACTTTTGTTACGATAATCATGTGACTAACTATGTGCCGTGTCTAGGCCTTGCTTACAATATGATAAC
AACGACAGCTTTCCGTGACTTCCTGATTGGCATTACAGGTGACCGCAACGTGACCATTCCTTCTCACAAGACGTACTATGACATCTTGGGCAAGCATTAC
AACAACTTTGAAAGCGAAACAAGGGCTCTATTGGAAAATGAGTTTGAGGAGCTTCATGGAACCGCATTTCTGACTGTGGATCACGATTTGTGCACGAACA
AGTCGAAGAACACTATTGTGGGTGCTTCTTGCGAGTTTATAGATCGCGAGTGGAAGCCTCGTAAACtggcgcttcttgcccaGGTTAAGAATGACGATCA
CGACTCAGCAGACGTTGATCATTTGTTGGACGACGAACTAATGCAGCGGTACGGATTGGATGTGGAGAAAATGGCGCGCTTTACAATACCGGATACAGCT
CCGGCCGCTCGTAAAATTTCTGAGCAGTTCGACACTACTTTGCAGACAGATTGTGCAATGCATGCACCTAATTTATGTATCGGTTATGGAGTCGGCTTAA
AAGAGAATACGAGGAACCAGTACGTACAAGACCCACTCACCAAAGAATTCGCAAAGTAAAAGATAGTTGTAACTCAAGGAGGTGTTTTTCCTGAAGGTGG
CTCTCTCATCCGGAAACTGCGATCCCCAAACAATTTTTTTGCTTCAAGCCGATCTCCCAAACGCATTGCCCGCCTCAAAGAAGTACAAGTTTTCTGCAAG
TTGCCCCAGCTCTCGGCTCTAATTGACATCGACGTACGTGTAGCTTCAACGATCAAATTGTTCAGACGCTCAATAATCAACTATGTTGTCTTCAATGCTT
TCTTCCAGAGGGCGAACTTAACGGAGAGTGAGAAGCAAGTGTTCACGTGTATAACAACCGCTGAATGGGAGTTGGTGATACAAATGGAGGCAGTGATGCA
GCGGATTGCAGACTTAGCCCTTGTCGAGTCACAGTCTGCAGCTATGCTATCGTCAACGATGTACGTGTTGCTGCGAGTTGCGTCCTCTAGGACCAATTCT
TACAAATTTATGGCGTATTCACTGAACGGAAATCGCAACACAGACACAAACGAGAAGAACTTTGCCCGACAGCGACTCACTTTGTCAGACTTGAGTACAT
TGACGCAACGATGCATCAACCGTACACTACACCAGATTACATCGCGGCTTCCTGCGCCGTCTGTGTCGATGGGTATGGCTCTACTTTTGGACCCACGCAC
TAAACGAGCTGTCAAACCCTATCTACGCATTCCCGACACTTCAGAGGCTGCAACCGATCTTATTTTGGAAGAGACAAAAGCGCTAATGCGCGTAGAACAT
CGCGTGTTTTTCAAGGCCCTCCATGCGAACGAGAACTGCGAGAATGAAAGAACGCCTTCTGCATCGAGTTCGCCTCGTGGAGAGTGTGATAGTAGTTCTG
ACACGGAGCTAGACTTACTTTATGGCGAAGAGGTCACTCAACCTGACGACTTGACATCCGTCGACACAACGCTAAACACGAAGGCGGACGCCGTGTTAGA
GCAATGGATAAACTTTCGAATCGAGTGGGAGGAAGCGGTAAGAAGCCAATACCCAGACAAGACACAGagagaacaagaacaagtgATTGCCAAGCTTACA
AtgtgcaacaagaagcagggGAACGTCCGAGTGTGgaacgtcgagcagctttgTCAGCAGATCGATGTCTGTCGCTGGTTCTCAGAGTATGGGCAAGCTC
AGTTTCCATCCGTTGCAAAACTTGCCCGCGTTTGGTTGGGGTGTTCGCGTTCCACGGCGTTCCAAGAACGTGTGTTCTCGACCGGTACATTAGTCATGAG
TTCGCTTCGGACTCGCACAGACAATGAGCGCGCTCAGCGGCAGCTGACTCTTCGTCATAACCGCGAAGAGCTTCAGCGCATGGACGAAAGCAAGCGCCGA
ATATGGT