Description :
From Genome Similarity Track
Location :
Scaffold_539:278- 1415
Transcript NameFunction/comments
Physo_145152hypothetical protein

Sequence
1137 bases(100 bases per row)
TACGTCTTGATCTTGAAGTCCAGCACCACGCCCAGGGAGCTGGCGGCGCCGCGCACGCCCCAGAACAGGTCCGAGTTCTGCTTGGCGTTGGCGTTCACGA
TAGAACCGTTGGCAAGCGCCACGCGCACAGACTCGATGTTGTCCAGCACCGTGCCGCTGGCGCGCGAGAGGGTGCCGAAGCCAGAAGCGGCCACACCAGT
CATGCCGACGTCGGGGCAACGGCCGTGGGGGAGGGTGCGCTTGGCCTTGCTCCACATGTAGTTGGCGGCCTCCGAGATCATGACGGGGCCGCCGTACGAC
AGCAGGCCAGTGGACGCGTCGTACTCGAGGTGCTTGAGGTGCTTGAGGTTCATGATGAGAGCACCGTCGTTGCGGCCGAAGCCCATGCTCGAGACGAGCG
GTTGCCGCCTAGCGTCGTCACCTTCACGCCGGCGTCGGCGGCGCACTTGAGCGCGGCCGACACCTCCTCCTCGTTCTTGGGGAAGGCAACGGCCGACGGC
ACGGGGCTCACACGCGAGTTCCACGCCTCCGTGTCAGCCTTCCAGGTCGACGTCGTGGGCAACGAGTTCTCGATGCCGGCCTTGTCGAGGCACGCGCCGA
CGTCAGTCTGAGTCGCGCCAGCGGCAGCAAAGCCGCCCTGAGCGGCGATGAGGGAACAAACAGCGAAGATCGCGCGACTGGTGCCGGAGATCGAGACCAT
GGTTCGTTCGTCTGGAGCTCGAGTTTCTGGTTGAAGACTTGAGTGCTAGGCGGCAAATGTAGGAGTGAGTGATTAACTGGAGAGCGGGATCATGTCAACG
CAGCTCCTCGACCACTTAGCGTCCGTCCCTGGAAGAGCCACCGCGAGAACGGAGAGCTCGGCGCAATAATCGCCAGCTGTGGACTTTCAATCGTGAAATC
GTACGCTGTGTATACGGCTGCTAACATGCGAGCACCGAGTCCGAAGTCCAACCTGGCCGAGCCGAGCATTCCAGCGGGTCGAGCCTAGGATCGTGAAACC
GCGTCTCTCTCGCGACAGCGACAGCGACACCACGAGCGCATTAATCCACGCGTGTATTAACGCAGCATCTGCTAACCTGGATGAACGCGACCCTATTTTC
CCAACACCGCTCGTTCTTCAGCAGCCCCCGACGGCTC