Description :
From Genome Similarity Track
Location :
Scaffold_244:2779- 7737
Sequence
4958 bases(100 bases per row)
AGAAGTCCCGTACTGGTGATAAGGCCCAAGGTGACCGACCGACGTAGAACGTAGGATTCGTGTGCATCTTACGTGGCAGTTCAATCGTGTATGCGTTGCC
TATGCGGCGCAGCACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTGGATAGT
AGGACTAGATCACCTTCGTTGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTTTTGTCGGTCCACTGCTTCTGCAATGGAATCTTGCACG
AAATGAACAACCGTTTCGCGAGCCAGTATGAATTCATTTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGGAGCGCACTGTGGCAAGGTCAGTGACCT
GGGTAGTAAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTTGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGA
TGAGTGAGAGCTGACTTGGCGTTCGCTCGAATGAGTCCCTCCCCCCCCTCAAACTAAAGTTACACTCTAAGAAGGTGGGTAGGCGTGGGTGGCGTAAGCC
ATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCTAATTCGTAAACGAATGG
ACATAACCCCGAAGGATTTGTTCAAGAACGCGGTTTGCACGTTATGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGCGTTCCGA
GTGTTTTGAACACGGATCGCCAGAATTCCGCAGTGAACCGTGGGTCTCGATTAGAGACGAGTTCACGAGGCAACCCATGACGACGAAAGATCGTGTCAAT
AAAGACACGAGCACATGCCGATGCATTGATAGATTCATTTACAGCGACCAGGTGAACCATTTTACTGAATCTATCAACGAACACAAGAACACCTGTATCT
TGTGTGGGTCTGCGGGGAATCCAAAGACAAATTCCATTGTGATTCCCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGGGAAGGAATT
GAATTCACTCGTTGACATACTTCGCATGCGCGGACGTACTTTCGCACGAACTGATACTGGTGGGGCCAGTAAAAGTCGCGACTAACTGTGAGATATGTCT
TCTCTCGACCACGATGTCCATCAGTAGGTGCATCGTGGTACTCATACATGATGCGCAGTCACAGGTCACCATGATCCGGTACGACGACACGAGGCGTGTC
GCCGGCAACGGCTGTATACTTCAGTAAGCCATTGTGGACTGTATATCTATCCGTGGAGGATCGATATACTGGGGGCAACCTTTTAAGAGATAGACGGGAT
GGTTGCGAGAGATGATCCATCAAGCGCACCATCACCGGATCGTACGCCTTGAGTATGTCTTCGAATAAGGTTGACGACGGGACACTCGACGTCAACCCCA
CGACAGTGGTCGGACCAGTGTCGGGTTGCGCAGCGGGTTCGAAATCGGGCCGGCGCGACAGAGCATCAGCGACGACATTCAGTCGTCCTGGATTATATTC
CACGGAGAAGTTGTACTCCGCGAAGAACGACAGCCACCTCGCCATTCGTTGCGAGAGGTGTGGACTGTCAACGGCCGTGCGTAAGGATGCATGGTCCGTA
TAAACGATATAGGGTCTATCACCTAGCAGATAGACCCTGAAATTTGCCAAAGCATACTTCATGGCAAGGAGTTCCTTGTCATGGACTGGGTAGTTACGTT
CAGTCGGTTCCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCGTTTGCGTCATACTGCATCAGTGCACATCCGATGGCAAAATCACTTGCATC
ACCGACCACATGAAATGGTCTGTCTTGGTCTGCAACCGCCAAAACTGGCGATCGTATCAATCTTTGCTTGATACCTTCGAAGGAGCGCTGGCAATCAGCA
CTCCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATCGTGCGATTATTTGTGCAAATACGCCGCTGGACCAG
GAACTTTCGAAGTCCTTTTATGTCGGTAGGCACCGGCCGGTCAGTGATCGCCTTGATCTTCTCTGGATCGGGCTGGACGCCGTGCTTAACCACGATGCAT
CCAAGAAGTGGTATTTCGCTAGCAGCAAATATGCACTTCTTGAGGTTGGCATACAACTTATGCTCACGCGTCAGTGTAAGAACCTTTCGGACGTGGAGTC
GGTGTACTTCTACATCCGTCTGTCTATCCATAGCCCGGCTATGGACGAACACGTCATCGAAATAACTAGGTGAGAACTCTCGCACAGATTTCAACAGATC
CGTAACGCATCTGTTGAAAGTAGCAGGGGCATTACTCAGCCCTTGTGGTATTACTAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACCGCAGTATAC
GGAATTTCCCTTTCACGCATAATGATCTGATAGAACACGTCCGTCAGATCCATCGATGAAAAGATGATACTCCTTGACATACCATCTATAATGACATCCT
TCCTTGGTATCGGCGTTTGAGCCGGTACAGTTGCAGCATTCAACTTGTTGAAGGCATGTACTACCCGCCATCCTCCTGTGGCTTTCGGATACAGAAGGTC
GGGGAGCTATGTGGGGAAGTAGATTCCCTCACATGGCCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACTTTTTCACGAGGCAGTGGCC
ATTTCTTCATGACACATACTTTGAACCTGGTTTCAGGTCGATCTCATGCCGAGTACCCTTATCCTTTGGTATCTCGCATGGCATTGTTTCTGGGAACACA
TCTCTAAATTCCATCAAATCATCGTAGAGAGGATTTGTCTTGGGCGATTCCCACGATTGGGATGTATATCGCTCAATCCAAGTCTTCTCATCAAGGACAC
TCTCGTCCATTAATGAGCTGCTGAGAACCCTTTCGTTTTCAGCGAATACCATTGCCGACCGAATATCGGTTACGTACTCGTCTTCCGCGACGAGTACAAA
ATTGTGCTTGACTTTGCCACTACGCATATCACGCAAGAACCTCTTCTGTTCGAGCGTGGGAAATTGAATGATCTACGAAGATGTCTTCGGAGGCGCGATC
AGATCAAGTTGGTAAGTGCCTATACTTAATCCTTGTTGACCAGGACACTTAATGTCTCTGTTGTCTCCTGGGAACTTATTTCCGCGGTTAGGTGGGGACT
ATTCCCTCACTATCCTCTATGGCTATCTCATACGAGTGGAATTGCTCCCTCTTTATCCTCTGGCGGTGGTTGCGCTACCGCGGCGGGTCTTCTACGTGCG
ATTCTCCAATCGCACTAAGATAATTATATTGCCAATCATTGGCAATCGGTTCGTTGTCACTTGGGTGTTGACCGTTCGGAGGACACCTATGCCCCGGTTT
ACTCGACTCATTCGGGTGGTGAGCCTTCGGCGCGACCTGCGTCTCAATGCAGTCGCCGGAATCTGGCTCCACTGTGTGCCGATCAGCCATTCCATGGCCA
TGTGTAGTCGTACTAACGACCGAACCACACGCGAGGCCATCGCACTCGCTCGTAGTACACCCACATGTTAGTGGGCGCTCCATGGCATTCATCAGATGGC
CATCTGATGATCAAGTGACAGGCATATTGACTGTTCGTCGATGCCAGCTGACTTGTGGATTGTACCTTCTGAGCCACGGCAGTCCAAGGATAATATCAAA
TTCGTCATCTAAGTATAATATGATGAAGTCATCATTATATTGGATTCCCTACAGTGAATAGGTAATACTAACTACACGTTTCATCACTGTTGCGGATGCG
CCTGTCGCGAGGCTCACCGTCATCCTCGTTGGAGGGATCTCGCGCTCAACATATTCGAGCTCTCTGATGTCTAGCGATTGGCGTCGTACAAAGGTGTTCG
ATACCCCGCAATCGACTAGAGCTCGAAGCGACATGCTTTGTGTCACTCCGAGTTTCAAAGTAATGAGGGAAACCTCATTACCAGAAGCAGCAACCCACAA
TGATAGAGTGTTGGGAACAATTTTCGTCAAGAGGCCTGCAAACACACTCGACGTTGCTGGATTAGTAGGGTGCTCCGCACCTACTGACCCTGACCATTTT
TTGGCTGTCCGTTACGTTGTTGCGAAGACGAAACAACGTCGGACCCATGCCTTGGACCTCTCTTGGCCGCTTAACGGTTATTGTTTTCTGCGGTACGTGG
TAACCGCGTTCGGGGCACTGCATTCGTATGCATAATGCCCTGTCTTCTGGCATCTATTGCATTTGTGCAATTTCTTATAGTTGTTAGCACGAGAGCTCTC
GCTCCTCGTGTTACAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTCGACGGACGATAGGAATTCGAATTCGCGTGAGCCTGTTTCACGCTG
AAGTCCTCCTGTTCCGCAACCCTTATTGCCTCTTCCAGGATTTTGAACTCCAACCGGAACATGTAGGTTTTAACAAGACCATCAGTCAGACCCTGCATGA
ACAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTACATCAAGCTTACCTTTCTTAATTCT
CAGGAGTTCAGAGCGAGCCCTGAACTCAGCTCGCGGCGGCCCAAATGTTTGCCTAAGCAGGGACTTGAAGGCTTCCAACGACCCAAAGACATATGGGTCG
TGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGAGCAAATGCTATCTGCATTTCCTCATCGACGATATGATGAGACCTTA
TGGCATCGTCTAGTTCCACGAACCATTTCAACAGAGAGTCTTCATCGGCTCCCTTGTA