Description :
From Genome Similarity Track
Location :
scaffold_1512:2779- 3843
Transcript NameFunction/comments
Pl_100588hypothetical protein PHYSODRAFT_258322

Sequence
1064 bases(100 bases per row)
GACAACAAACCTCCTATAACCCGCTGACGAAGCAATGCAGCTATTTACTCAATTCCTTGCGGCTTTTGCTCTTTTCACTGCTGGTTCTTCGGCTAAGGGC
GGCGAGGAGTCCAAGACCATCGACGATCTATACGCTGACGCTATTGCAGAAGGTGGCAAGTTGATCCTGTATCACGGCGGTGACACACCTACTCAACAGG
ACAGTCTCCGCCAAGCTTTCTCGCAGCGCTTCCCGGAGATCAACTTTACCGCTATCGTCGACTACAGCAAGTACCACGACGTCCGCATCGACAACCAGTT
GGAGACCGATACACTCGTCCCTGATGTGGTGGCGCTTCAGACGCTGCAGGACTTCACTCGTTGGGCTAAAGCGGGGGAGCTTCTTCCTTACAAGCCCGCT
AACTTCTCCAAGGTCCACAATTCGTTGAAGGACAAGAACGGAGCGTGGCTAGCATACACTATCTTTACGTTCGGATACATCTACAATTCGAGCGCTCTCA
ACGGCGGCGGATCTGACGAACCCGCAATATGCCAACAAGATCGCCTCGTCCTACCCCCACGACGACGACGCTGTGTTGTTCCTTTACACTCGCTATGTCG
AGAAGTATGGTTGGGACTGGGTGTCTCACTTGGCTCAACAGAACGTCAGCTTTAATCGCGGATCGAACGTTGCAGGCGAACTTGTGAAAAAATGATTGGC
GTTGGTACGAGCGGTGGTGGTGGTTCGATCGAGTTCGTGGGCGGCAACGGTACGGACTACTTGAGCTGGGGTCAACGTGTTGGCATTCTCTCGAAGGCGA
GACACCCCGCTGCAGCAAAGTTGTTCATGAATTGGGCTATTTCCGAGGAAGCCCAAACATCGGTAGTGTTCAACAGTGTGCGCACTGACATTAACGCGAA
CAAGCCTTGGGACGTCCCTGAAGCGAACATGGCTGCATTTCCATTGTTCATGGAGAAGTGGAACAGTGGAAGCAGACATTCGCCTTGTACTTTGGTGAAG
TGCAGGGAGAACCCAGTCCTGGTTTTCTTGGACTACACCCTGGTCAGTAATTCTGGCAGTCTGG