Description :
From Genome Similarity Track
Location :
Scaffold_29:27783- 33598
Transcript NameFunction/comments
Phyca_LT1534568437COX19 homolog, cytochrome c oxidase assembly protein
Phyca_LT1534115921Hypothetical protein
Phyca_LT1534115912SET domain protein

Sequence
5815 bases(100 bases per row)
cactgcaggtaggcggccgagagcttcttgcagtcaatatgactgttaccgtgttcacgcatgcaggccaggaactccttcatcgccggcttgcactcgc
catagtggtccaacgggaacgagcccttctcgggcggccgcttgctctgcgaaggcgcctgcgctgcgttcattctcaatgcggaatggtcgaaatggcc
acctcagattttatttacaaaactagactcaatgaagacctcctcagattttatttacaaactagactcaatggcacctcctaaactgtattaccacaac
ctagagtgaacctagagagttacgagtcgtgctgggagatggcccttttggttgagcttaaaagtacccaaataaaatttgtgtacttccctgggcagaa
atgattgtcaagagaaacagaggtaatttccaaacgagcacatgttttgcagcgaaaagagtcgcaatcggtagattgaaacctcctcttgacaaggctt
tttcgagcggcgaaaaatctctaatagggggagtcaaaccttggctaaaatccgaaatatcacactttcatttcaaaaaaataactgtgaaatctgagtg
tgatatccaacatgccattacgaatagagaaccacgtattttcacccaacagtacggccttcccacaccaaaaacgggtgggcacccatagctcctgcca
acacaacacgctatggaggaatcacaaatagattgttgtgcctgtgcacgctgccacttttctacaaggcgcgccagaacggccacagcggatcgaatat
agcccaatcagagcccagcgagagctaaccctagcccaatcggagccacgcacatatcctgattcaaaaatttgaaaactattgtgcccttcacctgctg
ctcgacggcgctcgacgagatgcccaagcggatcgactggagggacgtggcgctagacacctccaccctcgacgccgagggggtgctggccgccatgaag
acgtacgaggtgaccaagtgcaaccaactggcgtgtgtgatgtgcccggaggacgccccacacaagatgcgctaccgcctattgaactgtgcgtcgaagg
cgtgtgctgcatcaatttcctcgcatgggcaggtgtgcccatggtgggggaagaccttatcgtgcatgaagaacgatgtggtgtcaatattccgggtggg
ggagcatgttacagctgccaggtcaccaggaaggaagcgtttgacgcccagccagaaggcctacgttcaggagctgaccctacatcatctccgaccaatg
cgaatcaggcacgctatgtcgcggaggtttgagacggtgctccaggaccttccgagcctgagcaccgtccaaaacttcgtacaacactactcgcggacca
gcctagcgcgcaacgaccgcgtaggtgacctccgcaagtggatccacgagagtgcgttcactggatacgaggacttggcccagcctttcacttatgcgtg
ggacctagacgccgacggcaagcctgttgtaggcaacggctccgacgagcgacctttcgtcgtcggtttgactacgaagacgctcatgctgcggctaatg
aggcctcccgactcgttcgtcctacatgttgacgctacctacaagctcaactaccgggggtaccctgtcattgtcgtcggaatctccgacagctcgcgcg
tgtttcacctggtgtcgatgtttattgtgtcgggtgaaacccaagccattatacagccgacgctcatggcgctgcgtcgactgtacaatgtactctctgg
gcatgaccgggtggtgcagtacgccatggcggatgcagatcaggcacagtataacgccgtcaacgctgtatttggcgataacccgcgcttcatcagcctt
atgtgctttttccacgtgatgtagaaggtgtacacggcgattaaggcatttccctcgtatacacaggctataatagtgcgtgatctatacgatatgcact
ttgcgcgctgccacagcgagttcctgcggatgcgggaggactttttgaaacgtctgagggacgtacagcagctggcgagcttcgcgcagtacatgagcgt
tcaatggctgagcggacggtaccctacctggcagctctactggacgcgcaccggattcgcgtccacaaaaacaacccggtggagacgtttaatgctgtgc
tgaaacgcgattacacacttcgccgccgactgaaaatgggagcgttgctacaggagctgagcaactgttgccaggataaatctgagagcgagtgattctt
cagcctggaggtggttccagctcaaaccctcgtacgcagagtctccgagatgatccgcgagaagcttctgtatgaggatggatgcgatcaaggcaatatt
gcgcccactggatacgtccgtgtgatttcttgtccagctaaacgtattcaagtgtccccgaacaagcgcagtggagaaggtattgctgtgactgcccaga
tgggtgtaaactacgctaggatggagttcgaggggcagcatacggtggctgggtcgttgacaccacccgtatgtggtgtcagcgcaactactggttcggg
tttggagtttgcgtgcacgtcctcttcgcacagcgtacactcgagtacctggactgtgctgggcgtgagattctggtcacgcgcggcaaggggaagaacc
atgtagacgattctctcctccgtaaagggcaacgtggtggccgcccgctgggggttggccctgcactgacgtattgagatccagcgctcgggtgcaagtt
gtacgagttgcgcctagctgccatttgcattgtatgagttgaaccagtcctcgaccattcgaggactttgcatatttgagatttagtgcgtgtgctttca
cttactgtatcccttgacgtagactacttctgggagagaggctctttccagcacgagtggcacgcacacttgaaccagatctcgttaccgtaagggacag
tgatcttggctccaatatcgaccgtactgagcatacggcacagcacctttacctgcgtcctgttctgcatttcgacgaattctacgttggggcggcacgc
gtgctgcaagaatctcgcgatagatccagcagccagcgcctcgacgtacacaacgtttccacgcctggtcctcgttcagcagcatggtatatccgctgtt
ctgcttcatcgcctcctccggctggccttcgcgcatggcctcgtactcctgcaatgtcccgcagtactccgcaatgatctcgccagcccacaacttctcc
gtcgtgtacacacccaggcctagacgccgagcatcgtaaatccgtaggcctgggtgagtacgtggagcgttgctgcagcgtgcctcgagtcggcagatgt
ccggtgcacagtagaaagcggtatccgcgttcctgcaaacatgtgcgaagcagtcgccgtagcatacgcacgggtcgacgtcgccggcgtccacgaactt
taccccctccgtaacaatgttctccgatatctctttcacgtagtccggaaacgggacggccgcaatgacggccgtctcgacatcattggggtcagcttga
gaggacgggacgtacacgggtttctgtatgcgcacgttcgccaacttcgctctcatgcccggcattagcagcaactccttcatcgtctttgccttcaaat
tttgcgcatggtagatgttggtgccgctgcgggttagcgcgcgtctattctggtaacgtttctttcttgatttagggacgtggtagtcaacctgctcacc
ttccgtctgtggtgctttgcctcacgctgcgcgagcgtgggtaccgccaaaatctcatgtaggacggccagctgagatggagtggtttcctcagattgca
cgtgcgcgtcctccacaaccacctcgcatccactatctctgactcgtttaactgcagaattcacaccgctggtcttcttctttgtcgcctttttcgatgg
aggcttcctgtctgctctttcggaggttccctcggatggatgaccttgtgttggggtggaacgagccttaggtggagcagcaggggcagccaaacgacca
cggggagtgctggccagcttatacacggcaggcttcttgacttcacgctgttcctttgcgttagtggttgctgtcggtactggcgccttttcctcgtatg
tatcctctctgtcgggctcgtgcgcattcgaatggccgcaaacgacagtcagagcagccgtggttgagacgctggacgtcatcaaagtcgcctggtcgcc
atccgaagctctttccatcgttcccggcgctacctcggtctccatggcggggcctgtgcgatgtaggtccgtaaaggcatcggtaatgatgttctgaacc
gacgcagcgaagcgggtgcggtccgaaggggcctcaaactcgcccggtacaagcgtgtaggtgcgcagcttgcgccagtaacacgtcacctcctcgccgt
cccgattgaacaccttcttgatcatcatagttgccgggatgatctcatccgttgagaccttgatcggggcgtccgcttcgtccggcgagtcatccacgcg
cgtcacaactgcagtacgagagccgcgggggtcgccggcgacgtacatctggctgtggtaggtgatcctatcccctgcatacagcttcataggcgcgagt
tgcgcggcggacagcccgaccatggcggcgtggaggagagtggagaatgcggcggtcgggctcttgaggcacgtctttcaggaactaatttctgctccga
caggccacaccaagcacgcatccaccgagagtgaaggtctttgcgcgcgtctgccaccgcttcagcggggtaggggctctgcctgcgctgcgctggccgg
cagaaagagctggtctgcagcctcgcccatgtctttttgtgttcggttcatgtgaaaatacggtaatctcttacgaatatcacccaccttccgaggtgtt
tgatgtttcaaatggcattttgttttcctcaaaaagatacatgtgatttttaaaattgacatgtcattttgtgaaagtttacgtcaggtttgaccccccc
ccctaatactcacaaattaatcactaaatgtaggcagccgaacccgatgttgtcagatggtctaaattgtgggacaggaatagcgcgagctctcaagggc
gctagacgcctttaagcgcagcacaaccatcgcttttggccttgcgcccttgattcagctcagattccttattttaagcacttaaaacgccgcagtagtt
gccgagatactgtttttcgcctcacttctgccactgaacaacgatggccagccacatctccccttaaagcacagttcggaagcgaaatttaacaacgaga
gagcgctatgacatcgttctcttcatgctaatgtgcggcgtccgtggcgagcccgatcaaggtgccaatgaagaggctgctgtcaaattcaaggtctcaa
agcgtacaattgaccgcgtgtggacaagatttctggaaaaccgcgaccgagaatgaataagcggcgtggatagtaagattaagggctcgtctggtcgcaa
gaagatcaatcgcgacgacctcctaaggaaagttgctgacattccaatccgtcggcgcacaactcagcggtctttggccgatgagctgcacgtctcacgc
tctcgaggcgtgtcggcaagatatattgctgcttcatgaagacgtcgttatcaacgtataaatacatgtatcggtgcgaacgaatgcttccttttgaccg
agtctatgcacgagg