Description :
From Genome Similarity Track
Location :
Scaffold_249:2778- 5445
Transcript NameFunction/comments
Phyin_T30-4PITG_21047Putative uncharacterized protein
Phyin_T30-4PITG_21048Putative uncharacterized protein
Phyin_T30-4PITG_21049Putative uncharacterized protein

Sequence
2667 bases(100 bases per row)
GAAAAACAGAAAGAAACTCCAACGGAAAGGCGAGGGAATACCAAAGGAACACGCACAAAGTATTCTTTTCGCCGACAACCATTGCCGACATAGTGAATAA
GACGAAAGAGGTGCGACTCAGGTACTCCGGTATCAGCTGTCAATTAACCGAGGACGAAAACCTGCTGCGGCAAACATGATAGAACGGGGGCTGTCTTCAC
TAATGGCCATTGCTTCTGATTATTCGGAGGCTCAACTCGTGGTGCTCGTGCTTAGCGTCGTCGTTATAGCCGTCGCGCTGCTATCCTACTTCGTGGTAGC
TCCGGAGTACGAGAAGCACCTGGACAAGCAGTACGCAGCAATGGTGGACGCCTCTTCGGGGCGTCACTTGCAGAACCAAAAAGCGCACGAGCTGCTTCGC
GCACGATTTGATCTGCGTAAGCACAAGTCACTTGGCGCCTGGGACATCGAGTCTGGTTCTAGTGACGACGACGGAATGGTCCACACGAGGCGGCAACGAC
GACACTCACAAATGCGGATACCTCCAGCCAGCGCCTCATCATCGTTAGACATGATCAGTGAAGCGATACAACTCGCTCGGAAGGAGCGTAACGCCCGAAG
ACGTAAAAGCGAAAGCGATGCACTCAAACAAGCCAACATTCAGCGAGCAGACATGTTGCGTCGTCGAGTGCAGCTACGGAAACTTGAAGAGGAGATCGCT
GGCACAGTCAAGGCTAACGAGGAAGCGCAGGCGGCAGCGACGTCTAGCAATCCCAATCCTACTTTAGCTATCATGCGTCGGCTCTCGAACAACGCACTCG
ATCTTAGCGACGGTCGGCTCAAGATGCTGCAGGAGCACCCGGCTGACTGCGTCGAGGAGCTTACGGTTCTCGCTCGAGCTCAATCACCGATGGCTACAAC
ATCTCGAGTGGATGTCTTTGCCAAGGCGAAGGGCAAGATTGAGAGTGGACCGAATCTCCGCGAAGTGAAGCAAGCATTGAAAGTATTGCACGATGTGCTC
AGCTTTTACCTGTCGGTGGATCACCGTGACATGAACAAACTCACGGTGTTTTGCAACTCCCTTCTGCAGCACGACGGTCTCAACCGACTACGTGCATTTG
AGGCATCGCGCGATCAGGATGTGCGGGCACTGTCAAACTCCATTATCGAGAAGGCTGTACCTGCCATTTGGCACTAAGAGTGAGCTTTCTGCTCCTATTA
TCTATTGATACTTTAGGATGAGGCAAGGAATTCTCCTCCGCTTCTAACGTCTGTAGAGCTCCACTACAAGAACATGACCCAGTAACAAGTTAAGTAAAAA
TCTCCAGTCGCTTTAAGATGAACAAATACCGGTAGCGTCTTTATTGCCCTCAGTACACGTAGTATCCCAGCTCACAGCACTCCTTTTTAGTTGACATTTC
GATGACTCACATTTCATGTGTAGGCAACTAGTTTTTTTTCCAATGGAACGACGCCGCAATCTCGCTCAGCGAACTGGACAACACCGTCCTGAGTACGAGG
CGGGAAATGGATCCACCACACAGCAGAACGCTGCCGATAGTGGACGGTGTGAGCTTGGAGTTCCAGAGGATGAGCGTCTTGGGCTGGGAGGGGGGCGCTG
TGCTGTCTGCCACGAACTGTACAAATGCCACGTGGTCACTTAGCAGCAGCGGGCCGCTCTTCCTTATACTGTAGCGCACGGTGGGGATGCGATCTGAACC
GTCAGGCGGCCCCGCCGAGATGATCTGTTCCTCGACTCCCAGCGAGACGATCCGGCGGTGACCCACGAGTCCACGACCTTCGCCAGGAATCAACGTCGAG
CCGCGACCGACCCACTCCACGCGCAGCCACGCGTCGTAAGCCTCACCCACCGATGCATTCACCAGTTGCTTCAGCGCTAGCTCCTGTCCATCGCTGTCCT
CGTAGGCTTCATAGGCGGCAACATCGATGTACCGATCCGCCATGATTACAAGTCACACAATGGAATGACCAGGATTGGTTGAAATGGTTGAAGAAAGCGA
ATTATAACGGTCATGACAAAGAAAGTATCTTTTTAAGAAACGGCTCCGGGCAGTTATGTGGCCTCACCAAAAAGCGTGCGTAGCACTTGTCGCGAGTGGC
GACAGCGGATGAAATACATGGCAGGCAATTATTACCAGTCAAAATTGGCGCAATGAAGCTCTATTCCAATGCAGCTCTATTCCAGGTGACGGTTTGCTCT
GGCTGTAGCATTTCTTGCCAGTGTACTGAGGAAACCCTGCAGCGCTGGACGCAGGATGAATCTGGCGAATCCACCGCAGCAGAGAAGGTATCCCAGCACT
GATGGCTCCATCTTGAGCGACCAGATCACTAGCGTAGCAGGGGTGCTCTCTGGGGACGCCGCTACGTCCACGAACTGCACGAACGCGAGGTGGTCCTGGA
TCGGGAACACCCCAAACTTGTGGATCTTGTAACAGATCGATGGGATCTTGGAGTGATCTCGGCGGGCTGCGGCAAGACTCGGTCGCCCTCCATCGCTGTC
TACGGGATCATCAATGGGCAGCCCCGCTGATAGAATCTCCTCTTCAATGCCCAGCGGGGCTCCCCGAACGTGGCCGACATAGCCTCGGCCTTCGCCCTCG
TGCAGCTCCGAGCCCCCCGCCAGCCAAACTTGCTCCAACCATGCGTCAAACACTTCAGAGGGAGAGC