Description :
From Genome Similarity Track
Location :
Scaffold_623:2777- 9619
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_623-snap-gene-0.10Conserved gene of unknown function

Sequence
6842 bases(100 bases per row)
CAAGTCGACACCACCGAGAGTACTGGTGGTGCTGGTGTTCAGTGCCGCCCCAGATACTGCTGGTGTAGTTGTAACGAGAAGTACCTGTGAGGCTGATTTC
TTTTGAGGCGACATTGAAGTGGGCTTCAGTGACTGCAATGACGGAGTTGAGCGCACTTGGGCGAGTTGGCACCGTGGAGAGGCGAGCGGAGATCGATCTC
GATTTCCTTCGAAACTGGGAGTTTCCAGTCCTAGTCTCGACGAAATCTTGGACTCTTTACGGTGTTGTGAGTGCGGCGATCCGGGGAGCGCTGGGAACGC
CTCACTTTGTTTGCGTTGTGGCGTTTGTTTGGTAGACACTCGACCGGAAGCAGCTTGTCTTGATCCACTCATTCCTGCTCCATGTTGCGGTGATGATACA
GCAACTGAGACTGCGCTCGCTCTCTCATTACACTCGTGAATGAAAGTGAGCGTCTCGCGAGCCAGCTCGCCGACTGTTTTCCGATCGAGTGACGAGGTCG
GCCGATTCTCCAGCTCCAGTGCAAAGTTCTGCGCTACTTTCTTGACTCTTTCCAACAGTCCAGCGGGGGTTTGTCCTCCTGAGTGCTTGTCCTCGATACT
CTGTAGCAATGCGTGGTATTTCCCGAAAGGGTACGCTGCCATGGAGCGAATGATACTGACTACATGATACTGAAGTGATTCTGCGCGGGAAGCCGCCTCG
TCATTGCGCTCTCGCAAGATGAATGGCAGCACGAGCTTCAAGACCCCCATCTCCGCCATTTTCGGCACGCACACGAGCACGTCTTGACTCAGCGCTGCGA
TTGCCCCCAACGCGTGGTCGAGGAGCCGCCATTTCTGGTGGTTGCCTTTGCCATGCAGAATCGACGGGATGTCCTGCTCCTGCGCGAGTTGCATCATGAG
CTCAAGCACGTGGAAGTGCAGGAAGAGCTCGCTCGTGTTGCCCTCGATCGTGTTCATCATCGCGAGTTGCTGGATCACGACAGCGATTTCGCCCTTGCAG
TCCTCGTCGGCACTTTTCTTAGACTCCCTGTGCCGAAGCTGGAGTCTTTTCAACAATCGAGGCAACACCTGCGCTCGCATCACTGCTGTTCGTCCCCCTG
CGACAGCGCAGAGCTTACCTATAAGCGTAAACAGCGAGGCTGGGACGTCGAGCAGACCGTGGTCGTCAACAAGAGAGTCGTGCGCGTAACTTGTTTGGTG
CTGCTGCTGTCGAATCGCGCCTTGATCAAATAGAATCTCTGGCAAGTGGATGAGCGCGATTTGGAGGCAGCCCTGCGTGAGAAGCAGGCTGCAGGCTGCA
TTCGTGCACGCGAGTCGACTCAGCGCCGTGCAACAGGTGCTCACGAGCTGGAAGCACGCGCTCTTCTCGCGTAAAACGTGCAAGATCGCTGGTGCGACGA
GCTCCACAAGCGACACCAGCTTCTCGCACGCGTAGCTTCCCTGTATGTTTGGATGCGGAGAAGTGCCGTAGGACTTGAGGAACTTGGTTCGTGAAGCCTC
GCCAAACGGTAATGGTCGCAAGTAGCCCGCGAGCTCGACCGCAGCGAGCACGAGGTCGAGCTCCAGCTCGACAAACTCAGCCCCACCACTCGGGCTCTTG
ATGCTCGCGATCAGATCTTCTAGAGCGTGGAGGCGAAACATCACGTCGCAGATCAACGCCTGAGGCAACTCGGGCACATTCGCGGACGTGATCGACAGCT
TGAGCTTCGCGTTGACACTCGTACTTGGACATCGGCTGAGGCGACTCAGCGCCTTGCACGCCTCTTTCGCCCCCATTTGGTGGATAAAGCGCTCTTGGGG
GGAAGTTATGCGAGCTACCAAATGCTCGATCTCGTCCAGTCGATTGCACTGAATCGAGAGTGCTAAGTGATTCACGAGATCTTCTGAGAAGCAAAACTGG
GCAACCTGAGGCACTTTGCAGATCCGCCCCAACACGATGCAGCTGATGTTACGCTGCCTTGGGGTTTGAAAGGGTGAATCCATGCAACTGGGCTTCACTT
GGATGAGGAATTGCAGCAAGCTGGGCAGCGCATTCACGGACAGCAGGTAGCATGTTGACTTATCAGCACTGGTTTCTGAGACGAGGTCCAACAGAACGCT
GTAGAGCGCGTCCAGACGATCCGCTAGTGTCTGCAGCGATGCGAGCAGCTTGGAGGACAAAGTCGCGTGGTTCGTTTGCCTTGCAAGCAACGCGATCCCA
ATCAGACCCAGCACGTGCAACATTGGAGTCTTTGTGCTTTCGATACTGGAGCTGCACCATCCCAGGAAGAGCTGGACCGCACCAGCCGTTGTGAGCCCTT
TGCGTGCGTCTGGTCGATCTGTCAGCTCGTAAAACATCAAGACTGCAGCAGACACGACTGACGGGTCTTGGTGTCCAAAGAAAGAAGTGACACTCTCGAG
ATGTCGCCCTCCATTGCGAGTCAGCGCCTCCAAGATCTGCGGAAAGCCAAACGAACCCGCAAGCACGCGCAGTGTGTTGACTACTTTGATACACAGACCG
GCATTCGCGGAGTCGTATTGCAACGCGCAAAACAGGATTTGAACGACAAACGGCGTGATCAGATGCTTCTCCGCGCTCGTCTCCAGCATTTTGAGAAGGT
AAATATGCTCTGAGCCGCTGGGATCACCAGGTCCCGATTTGTCCATGCTCTTGAAAGCCGTGTGGGCTTTGGTTTTGCTTAGCGATGCACCCGCATACTT
GCGCTTTGCAGCCAGAACAACCTCAGAGAGCACGTTGATCAGGTTGATGGAGCTCATCAGCGACGGGTTCGTCGACTCGACTCTCTGGTTCATCAAATGC
TCGACTTCGACCACGACTCGGTGCACCGCGTTACAGATGAGAATGTCCACGATCTTGTCTTCGCCCTGGTTCAGTGCGATTTCCAGCACGATCGATTTCA
CCATCTCGACGATTTCTCGCTTTTGGGTCTTCGTGATCAGCGATGTGAGGATCACGAGCGCCCCCGAGCCGACGATTTTCCTCTGGTCCGCGATCCTCGC
ATTAAGCGCTTTGTCACTGCTCCTTATGTCTCTTTCAGAGGTGGTGGGAGACCCTTTATTGCTGGTGAGATGATGCAGTACCGTAACGTAGGACTCGACC
ACGCTAGTAGGCAGCCCGTTCGCATCCATCGCGTCTCGAAGCATTTTGAACTGGTGGCGCAGCTCGAGATGCTTCACCAAGTGCATCGCGCGCAGTCGAG
CGCAGACGCTTGGGTCGTACTCCTTTCTGAGCAATCCGCGCTCAAAGATTACGCCACGCCAGTGGTGCTGCACGATGCGTGCGCAGATTTCCGTCTCACG
CAACAGACAGCGAATGCTTTTCCCAGCCTACGATTGCCGTATGAAGATTGAGATTGTTAGTCGAGATCGCTCGATGGATTTCCATATAAGCAATGGGTGA
AGATTGCCATTCGTACTCACAGCATTTTCGCTCGACAGAATCGACGTGAACCACTCCGAGAGCACAGCAAGCAGCCTAGCAACGCGGAAGATCTTGGCTC
GGTTCGTGAGCTTCGACAGGTTCCGAAACGCTTTGTTCATGAGCACTGGGATGGTAGTCTCGACAAAATCCACCGCGTCTACGAAGCGTAGTAATGGAAG
TCGCAGTCAGTCAATCATGTGAGAGTACTTGCAAGGCTGTCTGAAGCAAACACAACGAGTGTGAGCACCTTCGTGAATCTCCAGCAAGCGAATAAGCATC
GTAGTCGCCAGCTCGCGCCGCTTCTCGTCGTCCGAGTGCTCGATCTCGCTGTAAAGCGTCTCCACCGCGCCGTAGATCTTCGCCTTGTTCCACGTACGCG
TGTCCCATTCTTGATCCAAAAGCATCGTTGCCTGTCATTTAGCCCATGCATTCACACAAATGCAAAGAAGAGTCATTAGCGTAGTGTGGTGACACACTAG
TTAACCGTCACTGCGTGATAAAGAGCTACACACAATTCGTCCATCGAGGATCGCTGGGTTCTCCACTGCGACATCGCCATCGCAGTCATCGTCACCCAGG
TCATCGTCTTCGCCTTCTTCCTTGAACCGACTGGGGATCACGCGCTTTGGTGCGCTCTTCTCGAGCAGTTTCTGCTGCTTCTTGTCGGGTTTCTTTGCGT
TCTCTCGCAGAATGAGCACGCGCCAGCCGACGTCGTGCAGATGCGCGGTGCCGACAGGATCGATTGTGTGCTCGTGGTGGAGCGCAGGGAGGATCTGCTC
CTGCTGCGCGTAGATCTTCTGCGCGTCGCCACTGACCTTGATCGTGCGGTCAACGGTCGAGCCCTGCGCGAGCTCCCATGGGAGCGGCTCCTCATAGGAT
ATCGTGGCGGGCGGCCGCGTTGACCTGGACATGCTTCCGGCTTGTTCTTCGAGAGCTCTTCCACGGACGCCGCGTTCAAGCTCGCGCATTCACTGATTCA
CTGACCGGCATCCACGATCTGCCACCAACCAGCTATATATAGCCGAGTTATATTTGGCTCATCACGCTGCTAAAAGAAGCCACCATCCACCTGTTTCCAT
CAATAGAATGAAGTGAGTGGATCTGCAATGCCGCTCAACATGCATTCCGCCGTTCTGAGGCTGCACCTCATGCAGATCTGCTCACCAACTCGATTCTCCC
TTGATGCTCACGTCAATCAGAGATTCGCAGTTGAATACACGCGAGATGTTCTTATGCACGCAGTAATCTCCATGGGTGGACCAACAGGCGCAGTACCCAC
CCACGTACCGCAACTCCGTGGCTCCCTCCCCATTATTAGCGCCACGCTGCACCGCACGTACACGAAGCCTTGCGTACCGCGCGTGATCATGATCATGAAC
TGGTACAGAGCTCCGAGCAGACGCACCACGCGTCCTGCAGTCACTCTGCTGCAATCTCCGCCCACTACGTCATTGGGTTCGTCGATTGTCCACAGCGCGT
CATCGCCTGCGTTCTCCGTTGAACTTGCGCCACGTCCTCGAAAAACGAAGGGAGATGCGCATTCAGAAGGGGAGCAACTGCGGACAGTGACAGGACTGTC
TGACTGGAAACAGCGCCTCCTCCTCCTCCTCAAGATCGGCGTTCGGTGGCGGGAAAGGTGCCACGAACAGTTTCCAAGTTGGCTCGCGCCACAACTGCTC
AGGCTGGAGCTCGCGGTGCCTCACTGGCATACCATACAGTCGCCAAGTCAAGGAGGCGAGCTGACCCATCGGACGTTTCAGGTCGACAGGCGCTTGCTGA
TGATTGATGCTGGCTTGACAAGTGTGGGGGGAATAGTGAATAGTGACAGCCAGCGCATACATTGCATGCATAGGCAATATGCTGGCGACGCGAAGGAATT
TCGCAAAGGACTACAGTGTGTACGGGTACGTGTAAAGCAGCAGCTCCTGTTGTTGCTGTTGCTGTTGCTGTGGTGCTGAGCGCAATCGAGTCGCGCTCGC
ATCGCGATGACGCGACGACCCATGCTGATGTTCTCACTGTGTATGATGAACGCTATGGATGAGCGTGTGTTTCATGGAGCCGCGAGCGGCTGAGCTGCGA
TAAAGTGGTGTTTTTCTTTTCCTTCGCGGGTACTACGGAACGCGTTCTTTGTTTCGAATCTCCTTTCCGGCACGAGCTGACAAATGCACCAGAAACCTGT
GAGTGCCGCGAATCTTGCCGTACCAGGTGGTCTCATTCTTTGTGCAAGTGCTTCCCAAACGATTTGCACTTGGAGCAGAGCACGTCGAAAGTGAACAGCG
CTCAGTGATACAAGCAGCGGCAGATTCAAGCTGCGTGTGCACACAGCAGTGCATCGCATGGAGGAAAGAAGACTGCCGCACAAAGCGTCGCCGGCACGAA
GCGTTGGGTTGATCGATCGTCCACAGATTCACTGTTCTCTCTCGAAGAAGAAGAAGAAGAAGAAACTGACTGTCTGCTGGCTGTATCTCGCCTCGGCCAA
ATCCTTCTTCATTCAACCCTCGCTCCCGCACGTCGCATACTCTTGGTCAAGCAGCAGGCGCTATGCACCAATCGTACCCGTCGTGGCCATTGTTCGAATG
GCTTCCGACCGCCCTGAGAAAGCAGACGCGCCGTCGCCATCATGTGCTGTTGTCTCCGCATTGCTCTTGCCCCTGTGGTCGTTCATTCTTGCTCATTACG
GCAGGCATCGTTTTTTTGGAAGCATTTTGCCTTCGTTGCATGTGAAATTCGCTAATCTATTGAGCTGTATGGGAAAAAGCAAATCTGTCGGACGGTTCAT
CCGCGGTTCAAATTTGAGATTCGGTTAGGGTTAATGGTTGAACCGTACATTCCATCCTCTGATTGGCTGATTGAGTGACGCATCCTTTTTTTGGCTTGTT
TTTTCTCGCCCGCTCTCGCTTTCTCTTGGGTCATTTGCCAATTTTCTCGCTCCTGCACACACGACTCAAGAGAAGCAGAAGCGAACAGCAGCAGCAGGAA
GTGGGATCAGAAGCGACCAACAGCGTGCGTTCGAGAATCTCCCACGAGTGTGCAACACCTGCCACACGAGAGAGATACTGCGACGACTCGACGCAAAGAG
GCTTAGGTCGTGCACTGAAAAGAGTACGTAAGGCGCATTTGCTTCCCCGCGTCGACGAGCGAACGCATCTTGCGTTTTTGAACCTGCTCCAACAGCAAGT
GGCAGTTGGGTTCAGAACGAAGCGACACGGCGCGGTACAACCACTGTGCCCACGTTCGTTGTTGCTCGTCAACACTTGCGTTTTGCGTTTTGCTCACTGC
ATCGTGCTTCCTCTTCCGCATCAAGTGGCGTGTTCAACACAAGTCCACGAAGCAAAGAAGGAGTTGTTGTATTGTGAGGTTGAACACACAAAATAGAGCA
TCACGAAAAGAAACACAGCAGCTACGTGTGTGCTGAAAATTT