Description :
From Genome Similarity Track
Location :
contig_265:2777- 3821
Transcript NameFunction/comments
g14961.t1hypothetical protein

Sequence
1044 bases(100 bases per row)
GTCACTCCTCGCTAAACTCGGTCCACTCCATATCGAGGACTGCGTAGAGAGCAGCTTCCAGCTCGGCCTTGTTGTCGTATAACGGCAGTTCCACACGGTT
GAAGCACGTGTGCACCTTGGGGAAGCCGCGAGTTTGCCCAGGCAACGGCCGCAACGAGAAGGGGCAAATGCGGCCGTCATAACTGGTTAACCCCTTGAAG
CCCTGCACTGGCACGCGCGATGAGCCCGTGGAGAACTGCAGGAATCGTGCACGTTCGTCCTCCGTGAACGCCTGAAGTACTTCCCAGAACCAGCCAACGA
CGTACGGGGCCTCGTCGAAACTGGGAGCGACCACGTGTTGCGCTTCCAGTCGGCGAGGTCGATCTCGGGAAGTCCGCACAGCACGAGCTCAAGCTCCTGG
TAGTCGAAGACCAGCAGCGCTTCCTGTGGGACGACCTCAAACAATCCAAGAGACAGAGCTTGCAACTGCGGCCCGTAGCGATCGAGCATGAGGTAGCGCA
GCTTGAGGTGCAGGAACTCTTGTTTGTTGGCGTCCGTCACGGGCTTGTCCCGTCCATCAGACACCAAGTCCACAGTCACGACTTCGTCATCCGCTCGTAG
CTCCGTGACGGAGAACGTGAGCTCCAGGGCGTCCACGCCGTCATTGTCTCGGATCCAGATCATGCTCGTGTACACCTCCGGGTCCACGTACTGCAGGTCC
GAGAAAGTGATTGGCGTGCCTAGGAAGTGCTTGAGAATGGGCAGACACAGCCGCGCCTGCATGGTCTGTCCTTCCAGCAGGGCGCGGCCTAGCAGTCTGC
CAATGCCCCGGAAGTAGAGCAAGTGGTCGGCCGTGCAGTCTTCAGAGTGCGGGTTAATAGCCACGGCCTGCGTGTGTCGGTGGCACGACATAAAGAGCCC
CAGCTCATCGTCCAGCAACCTGCCGAACAAGATGGAGAACCATTCTCGCTGCAGACCTCCGGCGTCGATACCTGCTTCCCCGACGAACTCGATGCGAAGC
GGGAAGTGAATGTGCTCGGGCTGAATGCCCAGCAACTGCTCCAT