Description :
From Genome Similarity Track
Location :
Scaffold_10:277650- 279071
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004678Protein of unknown function

Sequence
1421 bases(100 bases per row)
GAGTCCGCGATTCCGGTCGAGCGTCTCGAGACTCTCGAAGTGCGCGCTCAAGCCTGCGAGGCCGAGCACGCCAATCGCATTCACCAGCAGGCCAAGGATC
ATGTACGATTTCCGCCGCGTGCCCTTGATCGGGTAGCAGTCGGCGACGAGTCCTATGAGGAAGCTGAGCAGCATCGGGACCTCCACCAAGCGCACAACGG
CTGTGTTCTCCTGTTTCGTCAGGTTGAGCTCGTTGCTCAGCAGCGGCCGCAAGCACCCTTGCAGCGCGGAATACGAGATCACGGACGAGAATGTCGCGGC
AACGAGCCCCAAGTACTGCTTGGTGAACAGCCGCACTTGGCCGCCGGGGCGGAGACTGCCGTACATTTCATGGTTGTAAAACTGGTTCCCGGCCACGTAT
CGCTGCGTCTCGGACAAGTCGACCATACGGTGGCGCTTGTCGCTGCCGCGTTCGTGCGCGTTGCCGCCCGACGGCGACTCGAACTGGTTGAAGTCGACGG
CCATGCCGCCGTGCTTGCGGCTCATGGGCGGCGGCGGCATCGAGATGCCTGCCGTCGCGAGCATGGTCACCGGCGCTCCATTCATGACGCGACCTGCTGC
TGTGGTTGAGCTCTGCTGACCTGCTTGTGTGGGAAAAGCCCAAGTGATCCCTTTGAGGAGGAGGCAAATGGGCAGGAGAGAAAGGGCGAGCGGGAGCGAT
TGACATAATCTGGTCACGTGAGTGTACCTACCTACCTACTTAGTACTGTGCACGCTGCCACATTGGACGAGATGACCGTGGGCTTTCCGCTGACCACAGA
GTCACTCTCGTGGCCGCAAAGTCACGCGATTGGACAGGCAGCGAACGCGTCGGCGCACGCATCCCGAGTGACCGCACCAATGGACGCCCCAGCGGCGGTC
AAATTAAAATGCGGCGGGAGCGGACGAGAACGAGTTCGAAGATTGTTGAAGATTCCTCACGATCTGCAGCGCTTTTGACAATACAAGGTGAGAGAATTCC
ACGTTATGGGTAATCAGAAAACCTTTTGATAAGAAGAAAGCAACTGTGGTGCAAAAAGTAAACTTGATATCTAAAAATAAGTTTAGATGATGCTTTAGTT
GATCAAATTGCCTCTTAAGAACAATATGTTTTCGATTCGGTAACGGTGTTCATGTGTATAGAAGAGGTATTTAGTCATTGACACTACTGAATGCGAAGAA
CGCTACAACATATTTGCGTCCATTATCAACCTCCTTGTCCAGAACTGGCTTTGTTGTTATCCTCACCACCACGCACGCGCCCAGCGATATATTGTTCATG
TTGTTGTTCAATGAACCACGGCAGCAATAAGGGAAAAATGTGTCTGCACTTTCACAGCTTTTCATTGCATTGAGCCCATTGCACCCACTTTTGCAAATGG
CGAAGAACAAAAAATCGAATG