Description :
From Genome Similarity Track
Location :
Scaffold_1:2775801- 2781215
Transcript NameFunction/comments
Phyin_T30-4PITG_00529Conserved oligomeric Golgi complex subunit 8%2C putative
Phyin_T30-4PITG_00530Putative uncharacterized protein
Phyin_T30-4PITG_00531Putative uncharacterized protein

Sequence
5414 bases(100 bases per row)
TTTACTCGATTGTGTCGGTAACCGGAACACCAGACTCCAGAGTGGCAGTCTCCGATAATTCTTCGCTAGCATTAAACTCTGGTGCGAATGCCAGCGAAGA
CTCATCGACAGACTCTGTCGTCGCTTCGGTCTCGTCAGACGGCAAAGAAATCAGCAGACCTGCTTCGCGCATGATTTCATCAAAGCCTTCAATTTCTTTC
GCCACAGCGTTTGCGGCACTGAGTGCAGCAGCCGATGGCACGGGGAACAAGCGATGGAAGCATTTGATCAAATACGGCACAAGCTCAGCTCGAATAACCT
GTGAGAGCGAGCAAATATCAGCTTAAAATGACACGCCATCCTCTCAACTCAAGTTCAGTATTCCGTACCTCATTCATCGCTCGAACGGCGTCTGTAAGTG
CAGCTGCCCTTGCATTCCTCGAAGTCGTATTTGTACCTCCGCCATTACTTTCTCCAGTTAGGGCATGCAGATCCAGCCCGTTCTCCTCAATAAACTCGGC
GATGGTGAGCAACATGGTGCCGATCGCGCTCTGATACTTTTTGCCCAATCGATTCTGCAACGACGAGATGGTACACAGTCGCAATTCGTTCAGCGACGAG
AGTAGTGCGTTGGTAAACTCCGCCAGCAAAGGGAACGACATCAGACACCGTGGCGGCGAGTAGTCTTCCCCGTTGGAAGCGTTCGCTGTTGAACGGGAGA
CGAAACGGAAGTTGGAGCCACTGCCATTAGAACGGTACGATGCAATGACGATTGGAGTCTTAGACGATGCCGAGAATGAAGACGCTACCGAGGAATGCGC
CTTGAGGTTCTCCTGGAACTCGCGACAAGCGGACCGCCAGTATTCTGTCATGAGGTTTAGTACGTGGTCTTCGAAATACACGACCAGTACAGCTCGGAAG
TCCACACCGACACGACCCAATGACCCTCCAAAGAACAAACTCTGCTCAAGAATTGTCGCAATCGAGCTGAAGTCATCGATCTTCGGCAGTTGCCTGCCCG
CAAAAAAAACAATTAGCAAAGAGTAGGGTCGAAGACAGGTCTCAACGTACTTCATAAGGATCTGGATAAAGTTGGCGACTGTCGCTGTAGCCCAGCGACA
TAGCGGAGGATCCACCTTGCCATCAACATTCTATGGACGAGCAAAAAGATGATGAATCACAGAAAAACTCTCTGATGAGCTTAACACTTAAGAGATTCCA
GGGACGTACCTCGCTGCCGAAGATCGCGGAGTACTGAGTGATCATGTCGAACCAGCTCGTCCGCTTAATGTCGATGACTTGGATGATCTGCAACCAGCAG
TGCTAAATATCAGTAGGCATAACTTGCTATAACGATATGCTGGGACGTACATATTGATACGGGTCGGACGACGAAATGCCTCGACTCAAGGACGATAACC
ACACATTTCGGCACGTAAGAAACTCCTCCTTCAGCTGCTTCTCGTACTCCAATGAGCCCACAGCTGCTACTCCAACCAGAGCGTCAAGACGTCGGAGATA
CCCAACGATCCGAACACACAGCGCCAACTGCAGGTCCTCACGCAGCTTCTGCAGCAGCTTCTCGCGCATGGTACCGGTCATCTCGGCCACCTCACGCACC
AAACAGTCAATAACGACATTGCGCGAAGTCTCAGCACTCTCATCGGCTTGGAATGTCTCGTTGGCGAACTGAATCACGTCCAGAGCCGAGTCGAACAGCT
CGTTGTGGATGCATGCGTCTAGCAGTTGCGGGATCTCCAGTAGCTCCGTTAACTGACCAAGACACAGCAATAATTGCGGTAATTGAAATGTAAGCGATAG
CCAACGCTGCAATAATAATAAAAATACTTGTCACCTGCAAATAATGCTCGAAGACAAACTGGATGTCGCCGTGCTTGGCGACAACGTCCGCCACCTCCTT
CTGAAACTCGGTGCAAAATAACTGAAGCTCTGGGATTGCCTCTTCAACCTTGGTAGTCTCCTCCTTGAGCTCCGCTAGCTACGTAAGAGTAAGAAGTTGG
TGAGAAGTTATGCGGAGTAGATTTGAGAGGATCTAGACATCTAGTACACGCACGTCATCCTTGACGATGGCAGCGCACTGGTTGCTCTGGATGAAGACGT
GGTAATTCTTGAGCACGAGATTGCGCAGCTGCTCGGCCGTGTTGTCTGCCTGGATCTGCAGTCGCCATGGCTCCTTTTTGAGCTCATCGAGTGAGCAGGT
CTTCAGTGAGGCCTGCATAGGTGCTGATTCAGCACTGCTGAATCAAGATTGAAAACTGGTGTACTGTACATACTAGGGTCCTTAGAGATGATAATAGTTT
AGAGAGTCATCTTGTTAACTCGGCCACTCAACTCTGTGTAACTAACTGTCAATTCGCCAAGCCCTCTCATATCCATGAGTCATGGGTACAGTACTGTACT
TCCACGATTTCTTGTTTACGTACTACATGTAATACCAGCTAAACATTTGCTGCCACAGCGAATTGTAAGGTAGCATGTTGAGTCAATTGTTGACACTATG
GAGTACATGTACATGTATTCGATTTTCACAAAGCAAGTGACACGTTGCCGAAGTGGATGATCACTTCGCGATTGATGATGGTACACGCAGGATGCATTGG
AAGTTGGCCGCCAACTTACGTTTTGGCATGCCCAATACATGTAGTCACAATGTCCTGACGACAGCACTAGCCTGACGACAACACTAGCTGAATATTAGTC
AATTTGACTCTGCTGTAGCTTCATGCTACCCTATAACTTCTTCAGAGTTTGCGGGTCTAAACTCTTTTCAAGATCTCAGCTGCCTCGCGAAACTGAAGCA
GGTTGAAGACGCAAAACGGTTTCGAAACTTCAACCCCTAACCCGTCGTTTACGTGTCACTCTCGTCCTCGCTGTATGAGTTCCACTATGTGGCTTGTGAC
ATAAATAAATGGCATACTGACATCCATATATATGAGTTCAGCCGCCGATCTGCGACTTGAAACGCAACAATGTCCGCAGGAAGGTGCATGTGGCCGCGCC
GTCGTCACTGTCACGGCTGCACTGCAAAATATCCCGCAAACTCCCATATTCATTTTTGCGCGGCAAGAAGCACAAGTCTCGAACCTCCACAATGTTTACA
CGTAACATTTCCCTTGCCTCGCGCTCTCTCGGCACAATCAGTCGCCGCCACTTCGCCGCCGCCACCACAGCTACCAGCGCTAAGCGAGTGAAGATCAACG
GTCATGGCCACGAAGCGCAGGAAAGCGGCAAACTCAGCTACGTGCCCGAGGGCTCGGATGGAAGATTCTTCATCGAGCAACTGTAAGTAGCACGACGCCC
ACCTAGCTTGCAGAGCGATAACATGATAATTGTGCTTCGACAGGGATGAACACTGGCGCTCGGCAGTAGCCGGACAGACCTTCAAGAAAGACGATGTCAT
TGGCTCTGCCCCCGGCACTGTTGTACGTTGATACTTTACTTGTCTTCTCTGTGACGACGAGCATGGATGACTCACGCTGAAGTCGGTGGTATCATTGTTG
CAGTATCCAACGCCCACTCGATTTACAGTGCAGATCACGCCCGACAAGCACATGGACTTTGTGGGCGGACTGGAGTTCGTAAACCATAGTTGCAACCCCA
ACACGCGCATCGACATGTCCGAGAGTGAGGCCAAGGTGTCGTTCATCGCGATCAAGCCTATTAAGGAGGGCGAACACTTGACATTCGACTACTCCACGAG
CGAATGGGACATGAACGAGAAGTTCGACTGCCGTTGCGGTGCATCGACCTGCAGCGGCCACATTGGTGGGGCTAAGTATCTCAATAACGACGAGGTGAAT
GCTCGCTTACCGTACTTCACATCGAGCGTGTTGCGACAGTTGTTGAACCGCAAACTGACCAACTAAAATGCGGAACTAATATGATGTTTGTCAATGTTAC
TAAAGTTCCATGGGAGTTTGTATAGATTTTTAAGACGAATGAAAAACGAAAAAATGCACTTTAACAAAATTTCTTGATTTACGGACGGGTGGTGCTGGGT
GGATACATTTCAAGGTTGGAAGCAAGAACCTGCTTCCACTTCTCCAGTGTGTCTATCACACCTGTAAGCACTTGCTTGTCCTCGACACGCACACGCACAG
CGAATGACAAACGAGGGCTCGACTCTGTTGCCATTTCAGCCAAGATTGCTTCGTCCTCTTCAAGACTGTCAAAGAAGAGTATTTAATTAAGCCTGATGGT
TAGTAAATCAAGCAACAACAACGTAGCAACAACAATGTTTCCTGGACGTACGTTGTAGCAAAGTTCGCGAGCTTGCGGCGACAAGTATTCTGCAAGTTTT
CATACACAGCCAATTCATTGCGAATGCTAATAATCGATGTCTCAAAAGCCTGCAGACAAGTAACACAACTCGGTTAGTACCGGACCCAAAATCCTGTAAT
AGGAGGCAGCATACCTTTTTGTACAGGCGGATTTCCTGTTCGTTCATCAGAATCACACGCAGAGTAGCAAGAAGTCTCTCGTCGACATCATTCTCGAAGA
GGGTGCCGCAAAAGTCGTACGTCTGGTCGCGTGTGAGTTCATTCGAGTCCAGGACAGTTTGCTTCAGCTTCAGGTACGGGTCGTTAGGCGGGATCTTCAT
CCAGAAATCCACAGCTCGGCGTGAGTTCTCCTTTGCAACGAATCCGTAGGAAAACAGCAGCTTCGCGTTCGAGTATTGCCCGTAGCTGATTTGCAACGCC
GATCCTGCTGCCACCTCCTTTGGTACATGGTGCGTCAGCATCTGCGTCTCCTCATCGAACGAAACAAAGTCATCAAGCAGGATACGCAAGCTCACGTCGT
GGTTAAACATATCCATCGCTGGGCATAGCACACGCAGGTATTTTTTCTCTCTCGTCACTCCAAACGCGCGACTCCAGATGACGCTCATGGCCCAAGTGTA
GTCCTCTAATGTCAGCGTCGGTAACAATGCAAAAACTTCTGGGAAATCCTCTACCACAGCTTGATGAATATTCTCAAAGTCCCTTTGCAATTGCTGCTTC
ATCAGCTGCGTCAGTAGCAGCACGTTGGTGCCCTTGAGTTCGTTCAGCTCGGATTCCGACCAAAACACCGGCAAGTCAAACGTCGTGGGTAGTGACGCAA
TAAATGGGGCAAAGAAGGAGTCACTACGCTTGCTTCGTTCGTGCATCAAATGCAATGCTAGCACCTCATCGTCCGGAATCTGCGGGTACTTTTCCAGTAC
GCGTGCAAGGTCGGATCGGGCTGCAGACTCAATGTTCATCGTGAGCTTGAACGGAATTCGCAGCGTTACTTGGCCGCTAGTCAACGCCTGCTTAGCGAAA
ACGCCATGACCCTCAAGTTTACCAAGGTATCGGATATCCAGCAAGTTGTCGACTCCTCCATTGGCCTTTAGCCACTCTAGCAGCGTCGTCACCACTACAG
GTAAACTCATGGCC