Description :
From Genome Similarity Track
Location :
Scaffold_143:277501- 279709
Sequence
2208 bases(100 bases per row)
TATGTGGAAGGTATTTTTGAATTTTCTCGCCATACTTGACATAAAATGATGGCGTTGGGGCAAGGGGTAGTTCATTTTGTAAAGGCTAAATATGATGGTC
AAGTGTTGCTGCGTCGAGAGTTAACACAAACGGTGTTGTGGCACGAGCTGGTTATATGTCGCGCTCCCGGTTTGTTTCAAAGGTGCTGGCTTGATACGTT
GTCCATCGCTTGAAGGGCGAAACCTGCATGGCTCATGAACCAAGCAACTTCAAATTCAAGTCAATATAATATTTCACAAGATTTGTCTTTTTCGACTCGG
TGGGAGGAGCCACTGTAGCGACGATGTTACGAATGTCGGTACAGGTACACTCTGTACTTGCAAAATCCAACTGCTATCGAGCGAAATTCGAAACATGGCC
TTTGCGCACCGATAGCGAAGCAACATTCCAGTCCCACGCATGCCGTACTATGCAACAAAATGTCCTCTACATTCCGAATCGTCTTGGTAGAAGCACCTTG
ACATCACGAGGTGGATGGGCTAGTCCGCAGACCAGCGGACAAGGTGACGCAATGATATTCAAGAACTCCTGTGTGATTCATTCGTCGCCCCTTATAGCCC
GGACTTGTCCAGGGAGCTTTCAGTCGATCCCAGCGCTCAAGTATGAGGAACCTCCTTCAACTTGAATATCACGAGCATGCGTCTGCGGTTATGCCGTGTC
CAAAGCAACGTGAAAGCGGATTTGACAAAACTTGTCGACTATACTGATTCAAGGACATAAAAGGTCTCGATTAGAACGCGCTTCAAGTTCTGACTTTAAA
CGTGTAGTCCCGAGCTTGAGAGAGCCCCGCGTCCCCACGTACAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN