Description :
From Genome Similarity Track
Location :
scaffold_381:2775- 4010
Transcript NameFunction/comments
g7856.t1 nucleolar protein NOP5

Sequence
1235 bases(100 bases per row)
TGTGCTTCTTAGCCTTCTTGTCCTTCTTCTCCTTCTTGACCTTCGGCTCTTCCTCCTCCTCGGCGTCCTCTTCAGCAGCCTTCTTCTTGTGCTTCTTCGC
CTTCTTGTCCTTCTTGTCCTTCTTAACCTTCGGCTCTTCCTCCTCCTCGGCATCGTCCTCAGCCTTACGCTTCTTGCTCGACACAGTCATGTCGGCATCA
GCGTTGTACGACTTGCTCGTCTCCGTCTTAACGTACTTCTTGGTCTCGTTCTTGGTCTTGCCGTTCGAGTTGGGCACACCAGAGAAGCCGTTCTCCAGCT
GCCGCACACGGGCCTCCACCTTGGCGCGGTTGTCGAAGCCAATCGTGGCCTCCGTGGCGTCACCAAGAGCATCCACACGGACAGCCAGCGCCGTCTTGGC
AGCCAGCACACGCGAGATCTTACCCTTGTGCTTGGGGGCGGTCTGGCCGATCAGCGAAGCGTGGTAGATCAGACCGTACTTGGGGGTGTCGTGCTTGGTC
TTGAGGGCACGGAACAGAGCCTTCTCGGCACCAAGGATCTGCACGGTGGAAGCCGGGTGCTTGGCCAGGTTCATCAGGGAGCCAGCGTGGGCGATGAGAC
GGGCACCGACCAGCTCGCCCACCATGACGGTGAGGTTGGGAGCGATGGCGTTCATGCGGTTCTTCAGGTAGTCGAAGAGCTGCGCGCGGTACTCCGTAAG
GGAGATAACCTGCTCACACAGAGCCGAGATGTTGGTGACATCCTCCTCGGAGATGTCCGTACCCATGGACACCTCGCAGACCTCACGCATGGAGGCCTCC
ACGTCCTCCGACAGGATGTCCGAGAAGTCGAGGTTCTTGACGTGCGAGCGCACGCCCATCTTCAGCACGCACTTGGCGTACTGCAGGTTGTCCGTGACGA
TCTTGCCCATCTCGGGGAAGTGCCAGCCGAACCACTCACGCACGCGCATCGAGTACGTGTTGATTTCCTTGTCCAGCTCGTCCAGCAGACCAATCGCCTG
CACGATCATCGTGTCCACCTTGTCGGCGCTGAACTTGAGTTTGTAGCGCGAGAGCGAGTGCGACAGACCAAGCGTCATGGCCTTCAGGTCGTCGTCCTCC
AGGCCCGTGATGAGCGTGTCCATGTTGGCACGAATGCCACGCATGACCTCGTTGACAGCCGAGTCATTGACACAGGAGATGCTGAGCTTCTCCTTAATGA
GCGAGCCGAGCGCCTTGTCCGAAACGGCCAGCTTG