Description :
From Genome Similarity Track
Location :
Scaffold_1676:2775- 4007
Sequence
1232 bases(100 bases per row)
TTCGGATTCATGTGCGGCGGTGTCCCTGGCTGGGCCTATCCGTTGGGATACTGAAACAGGTTTGGTGCGGGTCTGTACAGCGGCGGGTGCGGTCTTGGCA
TTCCTTTCGGTGGTCTCTACCACTGTTAGTTCTTTGAGCTGTGGGCCTACGGAGTTAACACCTTAACAAAATAGTAGTGTGCTGGCCTTCCTACTACCAA
AATTTGCTTCGTCTACGACTTCGAATGAACAGGTTATCTTTTTTCATGGGCTTTGAGCACCTTTCGAGGTTACACGTACAAATTCATCAGTATTATCGTT
GTTAACGACGAAGGGCTCAACGTTAAGGCAAATTAAGTTTTGAGTGAAGAGACTGCCAACCATTAAGTGTAACCAGATTACATATATATAGAAATTTTGT
AGTGATTGAAAAAACATTTAGATAAGTACTGCTTCAAACATTTTTTTTGCAGTGTTATATTCCCAATAGGAGCTCTGTACAAATATCAACTTGCGATTTG
AACTGCATGCGAGGGATAATTGCAATACAGTACATTATTGCAGCGATCTAGAATATCGTCGAGGTTGCGCTGCAGAGTCCTTCCAAGCAAAAGCTGATGG
CATGAGAGGGGGGAGGGGGGCGCCAACTCTTAGACTTTGAAAAAGGGTTCCCGGGCCCCTCAACAACCCCATCCAAACCCCTTTCCGGGTGTATTACGTG
AACAACTTACTTTTGCGCGCTGTGGTACACTCTCTTGGATTACGCGTTTTGTCGACTATGCAGACTCTTCCGATGTGTGATAGTGTTGTACGTGTTCTGC
GCATGGTGGTAATTATTTTTGATTATGCGCGTTGCCGATTGTCCAAAGGTTTCACAATCGTCGCGTGCATGTCCATTGTGTTTTTCTACCTGTACATAAA
TCTTAACTAAGCCCTTGGTCCAAGGAGTGTTGAGTTCCCTGCGATAATCCACAATAAATTACAGGTGCAGGTATTGATACATGTTTTATTATAATACATG
TGCACCATTTCTAAATCAAATCGAGTATTTCCCAGATCAGCAACAGTACAGCCGATCTTAGCCGGCACGAAAAAGTTAGCTTTATTAGAGAAGGAGATAA
TACTTTGCACCTATAATGCGTTTTGATGTATTCACCACGTGATATGCTACTTTTTCGCCCAGCTAGCTTTTTTAAATTAAGCTAGCCGGGCTCCTATTCA
TTGTTATAATACGGGACATATCACGCGCCCTG