Description :
From Genome Similarity Track
Location :
Scaffold_1477:2775- 3842
Sequence
1067 bases(100 bases per row)
GACACGGAGCGGTTGGGTAAGTAAACCGCCCACGTGGCTCGGTGACTACGTCTACATTGCCTACGAAAATACAAATCCAGATGATGATGTGAACTCGTTG
CCTGCTGGATGGAGGAAAGGACGAGCTGCGTGGCAACGTGCTATCGCGAACGAGTTGATCCTTGCATGGTGGGAGGACTATTGCTGCATGAGTACTGGCG
AGTTTGAAGAGCCAGATACTTTCGGTGACGCTATGGAGAGTGAGCACTCATTGCAATGGAAAAATGCAGCTGATGATGAGTTTGATTTGTTGATGAAGAA
CGATACCTGGGAGTTGGTGCCGCGTGAGAAGCACATGAAAGTGCTGCAGAATCGCTGGATCTTTCGCGTCAAGTATCTAGCGAACGGAGAGATCGAAAGA
TTCAAAGCGAGGCTCGTGATCAAGGGCTTCATGCAAATTTATGATATCGACTACCTAGAGGTGTACTCGCCTGTTGTGAGGCTGGAGACACTGCGTGTTC
TCTTGACACTGGCGGCTGTCTGGAATTATGAAGTGCATCAGATGGATGTCACTACTGCTTTCTTGAATGGGGCGATTGACGTGGAGGTCTATATGGAGCA
GCCTGAAGGCTACAAAGTGAATGGCAAAGAGGACTGGGTGTGCAGATTGAAGAAGAGTCTGCAAGGCTTGAAGCAGGCGCCCAGAGTGTGGTTTCAGCTG
CTCAAGTCGTTCTTGGAGGAGCAGGGCTTCACGATGCTGCAGTCGGAGGCCTGCGCGGCTGTGAAAGTAATTGATGGGCAGTTGGTCTTCATCCCTCTCT
ATGTTGATGATCTGATTTTGTTTGCTCCGTCGATGGAGCTCATCAACAAGATGAAGAAGATGTTCGAGGATCGGTTTGCGATGAAGGATCTCGGGGAGTT
ACACTACATTCTAGGCTGGGAGATCACGCGGAACCGGGCCGAGAGAACGATGTTCATTGGTCAGCAGAAGTATGCCGAGACCGTGCTCAAGCGGTTCAAC
ATGCAGGACTGCAATGGCTGCAAGACGCCGAGCACGGCGGATCTGAAGCTGAGCAAGGCCATGTGTC