Description :
From Genome Similarity Track
Location :
Scaffold_718:2774- 3935
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_718-abinit-gene-0.49Carbonyl reductase

Sequence
1161 bases(100 bases per row)
CACTGACCCGTGATGTAGGACGCGTCGTCACTCGCGAGGAACGCCACAAGCTTCGCGACTTCGTCGGCGGCACCAAGCCGAGCGAGCGGGATGTTGGACA
GGATACGCTCTCTCGCGGCGTCCGTCATTGCAGCAGTCATGTCGGTCTCGATGAAGCCTGGCTCTACCAGGTTCACGCGGATGTTCCGGCTGCCAAGCTC
CTTTGCGAGCGACTTGGTCGCGCCCACGAGCCCAGACTTGGACGCACTGTACGCGGTTTGGCCAATGTTGCCCGCCGCGCCGACCACGCTACCAATATTG
ATGATGCTTCCTACAGAATAGTCAGTCCAGTGTCGCATTAGCTTCCACATTGCACAACGAGTACGCTATCAGTTCACTCACACACCTTTGCGCTGCTGCA
TCATGTTCTTGGCGACAGCTTTGCTCATCTGGATCGGCCCCACGAGGTTGGTCAGTAGCAGCTCGTCCAGCTCGCTCTCCTTGAGCCGGAGCAGCAGACT
GTCGCGCGAGACGCCCGCCGCGTTCACGAGCGCAGTGACCGCGCCGAGCTCCTTCGCGACCTGCGCCACCACGAGGCTCGCATCCGTAGCTGTAGCTGTA
GCTGTAGCTGTAGCTGTAGCTGCTGGTGATGCGGATGATGGCGGCACCTGATCTGCTCGAAGCGGCGCATGGTACGCGAGCGCGAGCACGTCACCCGAAG
TCGCTATGTGGTCGGCCGCCTGCTGCGCGCGCGCCAGATCGCGTGACGTGATCGCCACTTTCCAGCCGCTGCGGTGCAGCTGCTGCGCGATCGCAAAGCC
GATGCCCTTGCTGCCGCCCGTCACCAGCGCCACCTTGGCCATTTTTGTTTTCTCTTTGCCTCTTTTCGATGGGTGATGATGGAATAAATAATAAAATAGG
TAACTCAACCAAGCCATCGACATCGTACCTAAGAGACACAGTTCCTACAAAATAGCATGCTGGCGATCGATATGCGACTCAACAGGCTGCTGTTGTTTAT
GGCTTGCGACGTGTGTGACCATCACTCTCCTTAGACTGAAATCAAGGCGGTCCTTGCTGATACGCACTCACATACACTCACACACAAATCGCGAGACTGA
CTAACTCAAGTACGAGCCAGGAAGGAAGGAAGGAAGAACAGGAAGAAGAAGCCGCTGAGCC