Description :
From Genome Similarity Track
Location :
Scaffold_31:277314- 279160
Transcript NameFunction/comments
Physo_134339orf490

Sequence
1846 bases(100 bases per row)
AGCAATGTGGAGTTAACCACATAGCCATCGAGGTATTTTGGCCGCTTTCGCTTACGGGGATCGTAGAGAGGTCTCTTATCTTCATCATTGCGCCGACTGC
GCTTGTCCAGTTCTTGACCACGATTCTTGCGCTTCGAATTTTGCGCCGGCACTGGCACCAAAGACACAACTGATCCAATTCAGCTGTCTCGTGAGCTACA
CGCTGCTCCTCTGTTTCTGCCAGTTCGTACGTCTCAATCTCAATGGGCGTGGCTTCATTCTCGTGATCATCGCTATCATGGTCGTCATAAACATCATTTT
GACCACCACCACTCTCAATAATCGCACTCGGATCATCATCATTATCACTCTGCACCTCAGAATCACTTCCAGAGTCTGATTCGCTCTGCACAGTGTGCTC
ACTCGAACTTGTACTGCTAGAATCTGGATCATTTGCAGCTTCCGAGCCATCAGACGCACTACTCACGTCGTCGACATCGCCGTCAACGTCACTGTCAGCG
CTATCATGGGCACTTTCATCCTCGCCATCCGCAATATCACTTGCCTTTGGCACTGCAGAGCGTAAATGCACACGAAATCCACCCGGACCAGGTCGGTGCA
GCGGCCTCCATACCGCCGTCGACCTCTGCGGCGAATCAGCATCATCTTCAGCGTAACTATCTTTATCTTCAGAGCCAGATTCAGCATCCGAGTTCACTTC
GGCCAAACGAGAAATGATTGAAGGTGAAACTTCTGCTCGATCTCGATACAAAATAGCTTCATTCACTCGAACATCGAACACCACACGTGCACTGCGGGAA
GTAGACCTTCGTACCTACGCGATCCTCTGCGTAACCCAGCGAGTATCCGACCTCGCAATTGTTCGCCATTTTCTCCCGCAGCTTGAGAGGAATGTGCGCA
TACGCCAGTGCACCAAACGTTCTGATGTGGTGAATATCAGGCCGCTTACCGAAAAACAAACGTACGGCGTCCGAGACGCAATACTTCTGCACAAAACGCG
GTTCTTCACGTACGTCGTGTTCTCCAGCGCATCGGGCCAGAGACTGCTGGGCAATCCAGACGCAACCAGCATCGACTTCATCATACCACGCAGTGACTGT
ATCGCACGCTCTGCCAAATTCAACGACGACGCATCAGGAGCAAGTTCTTCATACTCGATGCCTATCTGTGCGCACCAGGCCTTCACTGTCGTTTGCAAAT
GCTCCACCATCGTCAAAGACCACACGCTTCACTTTGCGGTCCAGCTGGCGCTCCGCCCACGCGATATACTGCTCCAGCTTCTCATTAGTCTCCTTCTTGT
CCTTGAGAGGAAAGGTACGAATCAACCGTGAGAATCCATCAATAACCACGAGTACCTGATTGAATCGTGTCTTGTTGTGCTTGCCAGGGTCCATCAATTC
AACGAAAATCTCATCGTTAGGGTCACTAATACCACGGTCCAGCGAGTTCATGCGCTTCTTACGCTTCTGCTTCGCTAACTGACAAGTCTCACACATGGGT
AACTCTCGTCCCTTCAGCATCATACCGTCAACGATGCTCTTATCAGACATTGACTTAGGTATTGAGCATTTGTGCCAAACACGAATGTGAGCTAGCCCAT
CCATCGTTGTGAAGTTCACGACTTCAGCAGCGCGCGTCGCCTGCCGAGAGCCATCCTCCGTAAACGAGTTGTAACTACGGAAGCTCCACACGTTGGTCGG
CTGCAGCGTTGCAGCCAACAGGAACCTATCACCATCATACATGTTGTACGCGCCCGAAACCGGATCCTGCACCTCTGTGAGACCCTGGTCTCTCGCAATT
CCTGCCGAAAACATATTCCATCGAGCGCTCGGAACATACAGCACTC