Description :
From Genome Similarity Track
Location :
Scaffold_920:2773- 5505
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_920-snap-gene-0.4Transmembrane protein

Sequence
2732 bases(100 bases per row)
TACAGGGCATCTCACTTCTCGCAATCCACATTATGATGATCTTTGAGGCACATGCACCACTTTAGTGGGTGCTCCGGCCGTTGAAGCATCTCGCGCCGTC
TCGTTTCTCTGTTCGCAGAACACCTAAGAGTGGTCCGCAGCTGGATGCCGTGCACATCTTGGTTAATTTTGCTGTCGTTGCGCTGTCCACTGGTCCTCGA
TGAGTGAGCAGGCCAGTCTGCATGGAGACTGCACAACCAAGAGCTCTGACCACTCTCTCTAGGAACGAGCTGCTGTCCTGACCTGCATTTTCCGCGCGTG
ACTGGTACCTCACTCTTCGATTTGCCGCCATGAAGTCACCTCGCCAGTCCACTAACCACAAGGTAGAAGATGCTGCTGCCACCGGTGGCTTCCAGCCANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGAGGGCGGCGCGCTGCGTCCCGGTGGTACGCCGAACCTCCTGAGCAAGCAACACATCGGTCT
GATCCTCCAGTACGGTGTCGCGGGCATCGTCTACGGCTCGGTCTACGGCTCGATCTACCCGTTCCTGACCAACTACCTGCGCATGTCGGGCATCGAGACC
ACGTCGGCCGGTGTGCTCGTCACGATCCCCGCGACGCTCAAGATCTTCATCGGCATCGTGACCGACTGCCTGCCGATGTTTGGATACCGTCGCCGCCCGT
ACATGGTGTTTGGTTGGGTGCTCGCGTTCAGCATGCTGCTGGTCATGGCGTGCATGCCCATCGGCGACCCGTACTACCCGGACCGCGCGCTCGCGAACGT
GCCCGTGGCCAAGCTCACACCCGAGCAGGTCGCGAGCTTCAACACGAACGCGCCGGACTCGGGCGTCAAGTACATCTTCCTAATGTCGCTCGCGTACTTT
GGCGCCGTGATCGCAGTCACGGCGTGCGACNNNNNNNNNNNNNNNNNNNNNCATCCTCGTCGAGCTCGCGCAGCGAGAGCCCGAGAAAATCCGCGGCACG
GTGCAGACGACGATCTCCATGGCGCAAGACGGCTTCATGGTGCTCTCGTCGAGCATGGTCGGCTTCGGCATGAACGGCCGCGAGTACGGCGGCTCGTTCT
CCGGCTCGCTCGGCTTCAACGCACTCATGAGCATCTGCGCGGGGCTGGCGCTGCTCAACATCTTCTCGGCGCTCTTCTTCGTTTCGGACACCAAGGTCGC
GCATCGCCAGTCCGCGCGCAAGTACTTCGTGACGTTCTTCGACCTGCTCTCGGAGCGCGTGGTGTATCAGATCGTCGCGTTCCGCTTCTGCCGCAACCTG
TTCTCGAACTTTGGCGTGACGGCCTCGGCCCCGATCCAGAGCGTCTGGGCCCAGGTCGAGCCGCTCAACAGCAGCATCGCGACGATCCTCGGCCGCATCA
TCTCGGTCATCTCGCTCTACTTCCTCAAGAAGTACGGGCTCCAGTGGAACTGGCGCCGCACGCTCGTGATCACCCAGGTCGCGGTGGTCGTGATCGACTG
CCTCCCGACGTTCTTCACGATCTGGGACGTCTACCGCAGTCAGTGGTTCTGGCTCGGCGTGCCACTGCTTGAAAAGCTGCCGAACAGCATGGGCAACCTC
ATCTCCGGGTACGCCGTGATGGAGATCATCGGCGTCGGTCACGAAGCCTCCGTGTACGGTCTGATCACGACGGTCGCCACGCTCGCGTCACCATTCTCTT
CAGTGCTTACGAAGAACGTGGACGCGCATTTAGACATCGGTCGCTCGTTCCTCGTCGAGGACGACAGCCATGCGCGCACACAGGTGACGTACGCGTACCT
CATCGCGTACGGTTTCAAGATATTCTCGTGCGTCTTCGTGCTGCTGTTGCCGCGCCAGAAGAAAGAGACGCAGGAGCTCAAGCGCGTCGGCGGCAAAAAC
AAGATCATGGGTGTGCTCGTGATCCTCGTGTACCTGTTCACGCTCGAGTGGTCGGTCATGACCAACATGATGACCATGTTCACGAGCACCAAGTGCCTCG
TCATCGCGGGCGGCACCGGCTGCAAGTGAGAGCAGGAGAGGCGATAGAATAACGCAGTACAGTGCAGCACATGCATGCAACAAGACAATAAACACACTGT
TCACCATGGATTATTGCGTTACATCACGTCAGATTCCGCTATGATTGTAGCTCTCCATACCAATCAAATTGATTGACCAACTCTTGTGGAAGCTGTCACA
TTTATATTTGGCAAATGTGGAGCGTCCCAGAAAGGTCCTGCATTGGGAAAGTCTGGGATGAGAGGAGCACCACCGAGAAGCTCACTTTTGCGAGTTCAGT
CTCAAGCACCAAATCAAACCTCTGATGATTCGCGCTTTAGTACACCGAAGAAGCCGCATGACTCAAAAATGAGACGAGCTCCTTCTTCTTCTTCTGTCGT
CTATTACAGTCAGCGATGTTATTGTCCGTGTTGCGTAAAAGCCACGGGGTCTATGATATGATAGAATGGGAGCACCTACCACTCAAGTTGCCCTCCTGAC
ACCTGGTGCCACTGCAGTCACGGCAATCGGGTACAGCCAACCTCTCCCAGCAAATGCAGCCTGGTGTATTTGTTTGTAAATTCCCGCACAAGCAGAGCGA
AAACCTGCAGTAAGAACTTCCTTATATGAAGGAAAAAGAGTCTTTCTCAGTGTACCGCTTCAGTCGGTCGGACTTCTGAAGCTGAAGCGACACGTTGTCC
GTCATCCCGCGAATGGCGTTTCCAGTCAGCCA