Description :
From Genome Similarity Track
Location :
Scaffold_380:27724- 29264
Transcript NameFunction/comments
Phymu_g9294conserved hypothetical protein

Sequence
1540 bases(100 bases per row)
AAGTCAAGCCTGCGGGACTTCCACAATGAGAAAGCCCTCGCTGCATTCGCTGCCCTTGGACTGCAACTCCAGTGCGTGACTGTTGTCGACGACCTTCTCG
GGTGAGACCGCGACGACGTGGCGTCGAGCAACACGTGTCTCGCCAATGAACTCGCACAGCGAGATTTGAGCCAGGTCATCGGCCGAGAACTTCTTTTTCG
GGTTCTTCAACACCATGATCTTCGTGCCCAAGCGGTGGTTTGCTTCGGCTGGAAAATACAGCCGTTAGAAGGAGATTATAAATGCAAAGATGACAAACTA
ACGGGACGCACTCCGTGATCGAACGCCGTAAAACTGGCACACACTGTGAATAAGCAATCGATGGAAAGCCGAGTCCAGGAGCGGCAGTATCAACCgcacg
tccttctcgtttgcTTTCATCAGTTCGATCGGGTGTTTTAGCATTCGGAGAAGTGGCGTGgcgacttccagttctgACGGCACTTCTCGCCACTGTAGAC
AGTTTCAACAAGCGGCCAATTAGTCGAATACTACACCTGCACGGCGCTGAGTCACCGTACCTGAATGAAGTGCAAGACGACGTattcgacagcttcaatA
AACGGCGCAAACGAGGTAAATGAGCGCAGCATCAATGTCCGTGCCCGGCGGTCGACACGAGTGAACATTTGCTCGGCATCTGCATTGTCCCCAACAACAC
TATTAATCAGCATTCAACATAAAACGACACGTCTACAAACTTTAACTCACCGTTCCATCCATCTTTACGGCGATTGCGGGGTGCATGGGATCGGGTATTC
TCACGAGCGCCTCCTCCCTTACGGAACTCcgtttgcagctcttcgttttGGGGCTCTGCCAGCTTCTGAAAGTTCGATCTGACATTTTAAATCGCCACAA
TTTCAGTCCCGTTGCTTCAAAACAATAGGGTCTCTGCACCCACCTCCACTCCACGTTGATGTCCATGTGTTCCATCAAGTCCTCGAGTCTTGTGGACGCC
ACTCGGTTGCCGAAATGGTGGTCTGTCGCAACAGCACGTGAGACCCCATACCAAAGCCATTTATCCCCAGCTTATGCACCTTACCATTGAACCAGCGTTG
CTGTTTGCGCACGCCTACCGGCAGTTCATTGGGTTTGGACAGGTACCCGGCCGATCGGATCGGGTGGATGTTGATAAGCCGCTTGCTACGTGCCAGAGGA
GAGTCGCTGCCGCGTTTCTGCGGCGTTCGTGCGCGACTCGATCCGTTCCCATTGCTGCCGGAGCGCTCTACACCCGCGATCAGACTCTTCTTGGCGGTGC
CATCGTCAGCAGGTGCCTCGGTACGTAGTGGGGCGATGGGGCCCTCGCCCCAGGCcatctcaagctccagctcgctgCCGCATAGCGAACTGACTTCGGA
GTCGCTCATGTCTGGTGCCTCAGTCGACAGCTTAATCGTGTGCTCCGCCATGAGGCTCGAGTTGCTTGGGCGCTTATTCCGTGGTTGTAGCTTCCTGGAA
TGAGCATGCTTACTGGGGAAGAATGAGACCAACACTCATG