Description :
From Genome Similarity Track
Location :
contig_46:277086- 278401
Transcript NameFunction/comments
g8216.t1hypothetical protein

Sequence
1315 bases(100 bases per row)
AATCTGCTGTTTAAGACGCCCGTAGTCGGACCTCTGCTTACCAAAGCCAAGACTGCTATGAAAGTGGAAGAAGCTATCATAGTTCCCTTACTCAATCCAA
CCCTCCACATCAGGCATCTTGTACTTTTTACCCAGATTGACACCTGAATTTCCAAACCTGTCAGGCCGTGGGCGTTGATGATTTTTTGCAGAAGCGACTT
ATACTTATCGACATTGTACTGTTGGATCTTCAGCGATACATCACCGATGTATTTGAACATATCCGTCAGCAGCATCTTCGGATCGTCATTTACGAAGCAC
CGCACCTCCTCGGTTAAGCTATCAGCGACGGATACAGACACCGGAATGTGTTCGTTCGTGAAGACAGTACTTTCCCGTGTTGAGTCGCGGTAGGCTTAAG
GATTGCCTCAAAGTCATAAACAATGAAGTGGTCGATGTATTGATTGGCATCCTTAATGAAATACTTTGTAAGCAGTGATCGGATCGCGTTAGGAGCTGGC
TTGTAGATAGTTGGCTCAGCGGAGAAGCTCTCAATATTCACAAGCTCGCACTGATTTTTCTTGTGATTTTTAAGTCTTTCACCGCTCACGAAAATCATTT
CACACTTGGGGCACTGATACTTAAAATGGAGCATATCGATGTTCTTGATGTAGAGAGCGTGATTCTCGTGTGATAGAATATCCATAGCTTCATACCCCTT
GTCCAACCTACGAATGCTTTCAACATTTCCGGTAGCTACATCCATGCTTATACGTTAATACCGAGTTGGAAGCAGTCATCAACCTCATCGAGCTGTAATA
GGTCAATAGACTTGAAGCTACTAAATAGACTCAACGTATACTTAACCCCCTAAAAAGAGCAGTAGCGCTTGAATACATCCTTCTCCTGAGCCTGGATTCT
GCGAGGATCCTTCTTGGCGCTCTGGAATGTGTGCCAGGCGATGCAGTGGAAGACGCACTTGTTGTTAGTCTTAGGGAAGTTGATTACATGCTTGTTTTTG
CGGATACTCTTAGGAATAACAGCGTTGCTATCCCCAAGAGCATGGTCGCGATGGTAGACAAATCTTGAATGCAGTGATCGCCTTAAGCTTATATCCGGAG
CTGGTAGTTCAGCTTGTCAGCCAACTCCATAGACCGGATTTCCGAAATCACCTTCTTTGAATATCCGCCTTGCTGTTGATTGAGACAGGCTGATTGAATA
CATAGGTGTTAGTAAGATTCGGGTAGAAGTAGCGGGTGTCGTCAGGATCAGTTTTGCTCACAAGTTCGTACCCGAGAGCAATATTTACCTTAAAAGCACT
TGACTGAGTCGAAAG