Description :
From Genome Similarity Track
Location :
Scaffold_217:27707- 37342
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_217-snap-gene-0.21Metal-dependent hydrolase (Beta-lactamase superfamily)
Pytve_DAOMBR484maker-pve_contig_217-snap-gene-0.10Structural maintenance of chromosomes protein 5
Pytve_DAOMBR484maker-pve_contig_217-fgenesh-gene-0.7Cuticle collagen 2

Sequence
9635 bases(100 bases per row)
CATCGCGTATCAAATGCACTCACTATTCGTGAGGTGGCCGAGGGATTACGATGCGGAGAAAATCGGATGCTGGAACAACAGCACGTCGACCGAACGCGGA
CTGAGCCTCTAGTGCGAGATGCATTGTCGTTCGCGAGCGGTAGTCTGGTGTCCAGTGCCGGAAGCGATGGCTAAAGTGCGTGAGCGCTAACAGCGTCGCA
TTCATTTTCCTTGCAGCATAGCCTGCCATGCTAGCCGTCGAATGGCCTCGGTTCACCGCCTACACAATGCGAGTTACATAAGTGCATGGACGTCATGGGA
ACACACACACGCACATCACCAAAACGACATACTTGGGACACCATCTCATGGCTCAGAGTTGCTTCGTGCACGAGAACCTGCTCGACAGACATCGCATGCA
GGTTAGAAACACGCCGCTGAACCGCGATCGATGTGTCGGACGTACATCACACGACTGAGCGATGTCAAACATCCTCGACGAGTCGGCACTGTCTCCACAA
ATGGCAATTTTTCTTCCTCGAGCTGGTGGGCCGATCACCTAGCAACAATACAGCATCAAACTACCTTGTACAGCTGTAATGCTCAGCGGCACAAAATATG
ACTTACCTCGGATGGAGATAACACGTCTCCATTCGGAAGCCGGACGCTTCGACCGAGCTTGAGCTCGCGGTAGAGAGGACCTGGAGGTAAGCCGCGGGCC
AGGATTTCCTCCGACTTTAGTCTTCCTGGGATCGAATGCTCTTCGACAACATATCTACTCGCACACCATGAATGAGACACGAACCAATTCTCACCCAAGT
ATCACATCACATACCCGAAGCTGGTCACCGTGTGCTTCAATGCAGCTGCGCGGACGGTGATCTTCCCGTCGTCTAGGACGTCCCAGACGCAGCCGTTGCC
ATCAAACTTGGCGTGGATCTTCTTGCGGTGAAGACTCTGCGGATCAAAGGTGACGACGGCGTCAGCTCGACAGCTTTACCATGATTAAGGTGAAGCTATC
ATAGGGATCTCACCGGGTGGCACGGCGCGTTCTGCATGAACTTTTCATGGGCCGACATGTTCTTCAGCATCTCGGGCGACACGAGCTCGTGCACCGTGAT
CCGGAGGTTGGCCATCCGCGTGCTGCTGGTGGCGAGAGCCGTGTTCAGGTACGAGAAGAGTCCGAGCGGCCCGAAGACGTCGATCGGTTTCGGCGCGCCT
TTCTTGGTTGAAGGGTCAATGTACGCGGCGTTGTGGTTGTCCAGCGTGCACAGGATGCCCGGCAGCCCGTACACGTGGTCGCCATGCAGGTGTGTGATGA
AGAACTTGTTGGTGAGCGGCACGCGGATGATGCTCTTCATGAGCTGCCGCAGACTGCCTTCCGCGCAGTCGAACATCCAGTTCTGGTGCGACAGGCGCAC
GCACAGCGACGTCGGGTTGCGCCGCACGGACGGTGAGCCGGCGCTCGTGCCGAGGAAGATGAGCTCGAAATCGGTGAAGTCCACCTGCGCCATGTGCGGC
ATCAGCAGCGTGTTGCTGCTGCGCACCGGCACGGCGCCGAGCACGGCCTGCCGCTCGCTGATGCGGGCCACTGGCGCGCTGCGCCACGTCTTCGCACGTG
CGGCCCCGCGCGGCTCCGTGATCCAGCGCGGCCGCCGCATCGCCGCCGTTGACGCCTTCGCCGCCATGTCGAGTGCAACCTGAGCATTCGCAGCCACAGC
TCGTGATTTAGCGTTAGCCACATCATATTGTACAAATGCAAATATCTATGTGGGACACGCTATACTTTCTGACAATCCTAGTCTCGCAGTCATTGTCCGC
TGCTTTTCGCGGGAAAAGCGCGAAAGGCAAGCGTCCAGCGATGGCGGCGACGGACGTGGACTTGGCGACCGCCGAGTCGTCGGACGAGTTCGTGGACGGG
TCCATCTTCCGCGTCAAGCTGCACAACTTCCTCACCTACAACGACGCCGAGTTCCACCCAGGCCCGCGGCTCAATCTGATCCTCGGTCCCAACGGCACTG
GCAAGAGCTCGATCGTCTGCGCGCTATGCGTCGGGCTCGCCGGCAGCACCAAGGTACGGAGCGATCATGAGAGCGCGTCCACTTCACAGTATACTTAACA
TCGATTTGGCTGGCTGGGTAGGTGCTCGGCCGAGCGGACAAAGTGGGTCAGTTTGTGCGGCATGAGAAAGACTCCGGCTTCACCGAGGTGCAGATTGTTC
TACCGCCTCAGGAAAAAAGGGGCAACCACTAACGCTTGCTGGCATGGGATTGACTGCAGATCGAGATCTTTTTCGAGAAAGGCAACCAGGTCATTCGGCG
CAACATCTTCCGTGACAACACAAGCACGTGGATGCTGAACGGTCGCAACTCGACGCTCAAGCAAGTGGTTGCCCTGATGGAGACTGCCAACATTCAGATC
AGCAACTTGTGCCAATTCCTGCCGCAGGACAAGGTCGGCGAGTTCTCCCGCATGAATCCGATGCAGCTGCTCAAAGCGACCGAGTCGGCGATTATGGACG
GCGAGCTCGCCGTCAGGCACGATGAGCTGGTCGAGATGCAGAACAGCATGCGCGACAAGACACGGGTGCGCGAGAGGATGTACGGGTTATGAAGCGGCAG
TTCTGTTTCTGACAGTGGTGTTATCGGCCGCATCAGGATCTAGAGCAATCGCGCGCAGCGCTCGAACAAAAGAAGACCGAATGCCAACATCTAGAGACCG
AGGTGGAGCGCATCGTGGACTATGAAGCCCGGATCAAAGAGGTTTGGCTCTGTTGGACGTCACGCGTGGAGAGGCGGTGTGGACTGAGTGTGGATTCGTC
TTGGGATAACGTAGACGGAGTTGATGGAGAAGAAATGTCTCTGGCTGCAATTTGAAGAGGAGAAGCGTCAGGTGGACGAGCTCAAGGAAGACAAGAAGCG
CTGCCGTGAGGAAATGGATGTAAGTGTTATCTTTGCCACGAGTTGAACGTGGTCGAGACTCTGCTTGTGTTCACCTTGATTGCAATTGTCCAAAACAGAA
AGCGAAAGAGGAGCGAGTCGTGCCGCTTGAGAACCTTCTCGAGGAAGAAGTGGAGAAACTCGAGCAGCTCAAGTCCAAGTAAGCTACCGTCGGTGTATAT
TTCTCGTATCTTCGTTCAATCTAATCGTGACTATTCCGATCCCCCTCCAGGAAGGTGAATGCTGACCAGGACAAGCGTGAAGTTGACGAGAAGATCAAAC
GTCAGAAGCAGTTGGTAGGTCTTCATTCCCGCGAGTTGTCTATGACCGCTCCTGACTTTTGGGCTCGTGCGTTCAGATCGAGACAACGGAAGATTCGCAA
GCCAAAACGCTGACAGAGATCAAGGAGCTTCGAAACCATCACAACCAGTCGCGTAAACGTCTCGAAAAGCTGGAGCACGACGTGGAAGGCGTGAGTAGCG
ACTGCTCTGTTGTGTCCAGCGTCTTAACGAACAATGCTAACGGATGCATTCTTATCGACAGTGGAAGCGCGAGCGTGCTGCAATGCCAGAAGAGAATGAC
TTGAAGGTGCAGAAGTCACATCTCGAAAAGGAGCAGCGCGAAAGAGAGATGGAGGTAGGTTTCTATTCTGCTGTGAATCTCTGTTCCGTCGGAGGTGATT
CTGAGTTTATCGTGGTACGCAGCATGCGGAGATATCGAGTAAACGGCAGGTGCTTGTGCGGAAGCTTGCCACAGTCGAAAACGAAGCGAACCGAGTGATG
AGCAAGTTGAAGCAGCTCGACAACGAAGATGTCCAGCGCAAGCTAGCTCTCCAACGGTTCGATCCGGATGCGATTCGCGCTGCTGACTGGGTCAAGCGAA
ACCAGCATCTGTTCAAGCGCAAAGTGTGGGGTCCAGTTGTTCTCGAGGTAGACATCTCAGCCGTCGTGAATATCGTGTTGCTCGTCAGACTGACAGAGTA
TGTTTGACAGATGAAAGTGAATGAAGCTCTGCATGCCAAGTACGTCGAAGACATCCTCCCGAAATGGATGATGACGGCGCTGGTTGTGGAGAGCAAGGCA
GACTACGACACGATCCTCACTGGACTCCAAAACGAGGGCCAGCGCACCAAAGTATCTGTTGTGATTGTCGAAAACGGAATGTGCGGGCCAATCAAGCGAC
CATACAACGATGAACAGATGAGAGTGTTTCGCGAACGGTTCGGCATCACGGGTTACCTCGACGAGGTGAGATCGCCTCTATGGATCGTGTCAATTTTCAA
GTTTGGAATGACGCGGAATTGCTGATGTTACCCCACAGCTCGTGACAGCACCGGACGTGATTCACGAAGCACTCAGGGCCAATGGCGGCGTCAACACTGT
TCTTATTGGTACACACCAGACCGAGGATATGATCAACAACAACGAAGACGTGTTTTCTGCGTTTGCGAACAGCGACCGCTCCGCAGCGTTCGTCACTCCA
TTCAAGAAATACGTCACATCAGGTCAGTCGGTGTCATTGAACATATCCATCCGCCGCCACAATTGTACTAATATCGACGTCGTCGCGGATAGTCTCCAAG
TATGGAGCGCGGAACGTGACGACGCGCACCAACGACCTGCGCGACCCGCGGCTTTTGGGAGCCTCGTCATCGAACGAGGACGAGAAGAATCGGCTCAAAG
ACACGCTGGAAGGGTTTTCTGCAGAGCAGAGGCATATCCAGGAAGAGGTACGCATTCGCAGTAGCAATAGTCAACAAGTTACCAGACGCACTGACGTGTT
TGTTGGCACTTGGCGGTCAGATCGAGTCGCTCAAGGCACAAGAGCGCCAATTCGGCGAGTCGAGAAACAACTCGATGAGACGGATAAACGAGATCCGATC
CCAGCTGAAGACGATGATCCGACTCGATGAAAAGATCGGTGAGGCCGACAACAAGATCTACAGTTTGCGGAGCGAACTGGCGCGGGTATGTGGAGCGGTT
GTAGGTGCATTTGAACGATGGCATGGCTGATGGAAAGTGCACTCTAGGATCTGTCGGACAAGGAAGAAGCCATGGGACGGAAGCTCAAGAACCAAGGCGC
AAAGTGAGATTTGTGTCTGGGGCCGAATTGCAGCATGTGTTAAGCTTGTGCTAACGCTGTGTGTTCGCTATCGTTGACGAATGTAGACAGGGCCGGCAAA
TCAAGGAGTGTCTCAAACTCACGCAGGAGCTGCTCAAGTGCAGTGCGCGTGACGCGACGATTACGCTGCTGCTGAGTGCGCAGCAAGTTCGCGTCGAGCT
GACGGAAAAGGAGCTGAAGCGGACGGAAGCGACAATCAAGTACGCAATGTGGCGATCGTTGCATGCTCGGATGAACTTGTTTGTGTTGACGCGTTTGATG
ACTATAGAGCTCTTCAGGATGCTTACCGGATGGCGAAAGAGAATCTGATGGCCAAGGCGAAGCAAGCAATGAAGTTGAAGAAGAGGGCCGAGAGGGAAGC
ACCGCTGAGCGAGTACGAAGAGCAGTTTGCGACTCTCTCGGAAGATCTCGAAGAGCTGGAGGGAAAAATCGAGAACAACCGGCGAGCGTTGGACTGCTTC
CGCGGCGATATCAGCGTCCGAGACCGGTATCAGCAACTTGTCACGGAGATTGAGCAAGAAGAAGCGACGATGCAGGCACTGGAAGGAGACGTCAACAGCG
GCGAAGATCGTATCAGTGGCATCAAGGTGCGTGTCACTCAATCGTAGCGGGCTGTTCCTCCAAATTGCTGATCTACATGTTGTAGAACGCTTGGCATGCG
AGTCTGCAAAGAGTCATCGCCCGCATCGATGGCTCGTTCAAGGAGTTTTTCCAGGACATTGGTTGTGTCGGCGAAATCGTGCTGGACGATCAGGATCCTG
TATGTTGCTCGTGGATAGAACCCTCACCAAACGCAGCGGACTGATTGCAATGTTTGCATTCCTACAGGATATTTCGAAGTGGGGTATCCAGCGCCGAGCT
CAATTCCGGAAGAACACGAAGCTGTCAACAATGACGGCCGAGGAGCAGTCTGGCGGAGTACGGATCTCTCACTGACTGACTGACTGTGTTTATTTCTTGC
GAGCTAACGCCGGCTGGTGCAAAATGGTGTGCAGGAGAAATCGGTTGGCACCATCATGTACCTGATGGCTCTCCAAAACCTCACCAAGTGTCCGTTCCGC
GTCGTGGACGAGATCAACCAGGGCATGGACGTCTACAATGAGCGGAAGGTGTTCCAGCGCATCACGAAGTCGTCGTGCGGCAGCAAGATGCCTCAGTACT
TCCTCATCACGCCGAAGCTCATCACTGGACTCACCTACCACCGGGATACGAAAGTCATGGTGATTCTCAATGGCCCGTGGAACAAGGTTCGCCAGGAGAT
GTGGGATGCCGACCGCTTCATTGCATCCGCCAAGCACTCCAAGCGCCACCGAGTCGCGAACGGCAACGGCGACGTTGATTTATCGCGAAACAAGCGGGTT
CGGACCTAATGGTCAGCGAACAGCATCAATATGACCAGCATTGTTATGGACTGGAACGAGACAACGACCAAGACGGCAGTGTCTCCCACTACCATGCCTG
CTGTAGCTAACCGTTTCGCTTTGCAGTAGAGATCGATCCATTGTTTCCACTCAGCATGATGATTCGTTAGTGTTTCCATGACTCGGCCCAATGACAAGAG
CGTTGCTCGTTGTTTTGTCTTTACAGACGGAAACACCCTGGTTCATATGTTGACCATCCACCGTACTCTACATGAAGCTGAACGCGGACTGCCCAGCGCC
GGGAGTGCCACTTCCGTCATCGTACGTTGGAGCCGGCCCGGTACCTCGAGGAGAATTTGCAATCGTGAACAGGTCCTTACCCAGGTTACTCAGCGTTCTG
GCGCGTGCGGCGGCAGGAGATGCCTGGTCAGGGGGGATGCCAGCTTCTTGAGCGTATTGCTGCTGGAGGTGCTCCGGGTAACCTGGATACTGGGGATGCT
GGTGCTGCGGTACGCCAGTCACTGACGAAGACGAGCTTCCAATCGGATCAAAGCCATCGAGCAGCTAAAGGCATCGACGGTGACTGCGTCAGTACTCATA
CGAATAGGCGCCAAGCACGCAAAGCTACCGTACCGAAATCTCTTGAGAAGGAGCTGACGGCACAGGAGCAGAAGGCGCCGGTGCCGGACGCGCTTGCGGG
GAACCGAAGATATTGAGTTCAGGCGGAGCTTGGTGCACAGGAGCAGCAGGGGCGGGCGGCGGCGGTGGCTGGGAAATGCTCAGCGACTCCATACCGAGGA
AATCCACTTCATTCTGCGCCGATTGCTGCCGAGGCGGCGATCCCGCGTTCCTCGTCGGCACACGGCCTCCAGAGACCTGCCGTCGTGGCGGAGGCGGCCT
CTCCACCTGTTCAATGTCGAACCCGAGAGCCTGAAGCACCTGTCGCGCCTTGGATGCGACGCTCGGCTTGGGGTCTTTCTCCAGCTGGGACAAATAGGAA
TAATCAGACGTCAAGGACACCAGTGCCCCCCACACACTCGCTACAAACACTCACCTCCTCAACGACTTCCACGTTCTCTTCAAACCAGGCGACGTACGGG
TCCGCATTTGGCGACTCAAGCAGCGCGAGCACCACGTGCAAACCCTTCAACCGGACCTATGTCCCAAATGGATGCGTCAATCGAACGCTCACGTCGTGAA
AGCTCATTGTACGATTGACTCACCTGCCACGTGGGGTCTTCGAGCTTGTCCAAGAGGATGTCGCCGATCGTCTCCGAGTTGAGCGTCTGTGCCAGGTCGA
CGAACCGCTTGAGGGCGTCAGCTGGCGGTGCGCGTGCCAGTCCAGCAGACGCACACAGACTGTCAATCATGCCCCGCTCGTAATCCCTGCGCAGACATCG
CCAGTGTCAGTTCATGATTCGTAAAAAGAAGACGGCCAGTGTGCGCTCCGTACTTGCTCGCGTCCCCAGTGCCAACCTGCTGCGGCGTCGGCTGGTAGTA
GCCGCGGTCCATGACCTGTGGACCGGCACGCAGCTCGTCGTGGTCTGCAAGCGACGACGCCATCGACTTGTCCATGTTGCGGCGGTCCCACTTCTCACGC
GCTTCGTTGCCGATCTTCTTGAGCACCTCCACGCGCTTGCTCAGCTTGGACGTCGACGGACTGTTGAAACCTTGCGGGTTGGACGCGAACCCACCACCCA
TCTGTCCCATCCCGCCAAGCATTCGACTCGTGTTCTCCATGAAGCCCGGCCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGC
TTCCCATGCTGCTCATGCCGCCGCCGCCGCTGCTGAAGCGGTTAGCGCTCGAGTTGAAGGCACCTGAGTTCGAGTTGAAGCCGCCAGCACCTGCGTTCGA
GCCGAAGCCACCAGAGCCTGTGTTCGACCCGAAGCTAGTTGCGTTCGGGTTGTAGCCGCCGCCAGCGTTCGGATTGTAGCCGCCGCCAGCGTTCGGGTTA
TAGCCGCCGCTCGTGTTAGATCCAAAACTGTTCGTGGGCTTGGCGAAGCTGAGCGAGTGGCCCACGAGCACCGTCGGACGGTTGTCGCGGCGTGTGGAAG
CGCTGTATCGCGGCTCAGACGTCGCAGTCGGCTCGTTCTTCTGGTACCCGGTGCTGCTCCACGTACCGGCTCCAGTCGTCTTGCTCGGGCCGCCACCTCC
AGCCGGAGCAGCCCACGAATCGAACCCGGATGGCTGTCGACCCTGCTGGTAGCCTCCAGGTCCGTTCGCTCCGTCGTTCGGACCACCATACCCGTAGCCG
CCCTGATCATTCCGGCCGGCATTGGGATCGTACCCGCCGTTGCTGCTGTGGTTGCCGTGGTTGTACGTATCCGGACCATTGTATCCGGTCGGCGGATTGC
CGCCGTATGACGACGGGTTGTCCTGGTACGGTGGCGGTCGGAAGGACGACCCCATCGAGCTATTACCGCCCGACGGCTGGCCCCATGGCCCGCTCGGCGC
GCCATGGCCGTACGAAGGCGCCGAATTGTCGTATCCTGGCGCCGGCGCCTGACGAGGACTGTCATCGTTGGGACCGCTGGACTGCCAAGAGTTGCCTGGC
GGCGGCGGCGGCTCGTCCCTTTGGTCAGGCTGATGCTCAGGTCCACGGCGCGACAGGAACCCGTCGTTCAGACACACCAGCGCTTCCTGGGACGCGACCC
GTATCCGCCGGTACTTCTCATCGCCGTACACGGGGTCCGGCGGACCAGTGTACTCTGGAAGACAGGCAAACGTGAGCCATCAGACCTCGCATACACGGAG
ATCGTGGCGGGACGTACGGAGATAGGCAGAGATCTCCTGCTCGTCCTCGCGGACAGCGGCACCGAACGCTGGCGAGCCTTCCCGGATGCAGTACTACCAC
CAGACAAAGACATGGGTAAGACGATCCGCTCGGCATGGCTACACGCGGCCGCATAGGTGCGCGCTAGGACCCTACCGAGATGATCTGAAGCGCCTTGAGC
TTGACGTTCAAGTTGCTCTTGTGCAGGCGGCTGACGAGGAAGTCGGCGACCTTCTCGGCGTCCCGCGCGCCGGCCTTGGTCGAGTCTGACGGTGTCGGCC
CATACATAGTTAGCATCAAGCCTCCCTTTGGTTCACACGGAACGCCACGCACTGGCAATTTCCTCCATGAGGTAGACTGGCACCGGCCCATCGTGCAGGC
TCGTGGCCTCGGCCAGTGTCTGCCGGTTCATGTCG