Description :
From Genome Similarity Track
Location :
Scaffold_163:27705- 28856
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_163-fgenesh-gene-0.143-hydroxyisobutyrate dehydrogenase

Sequence
1151 bases(100 bases per row)
TGCTGGTCGATCCCGTTCAGCTGCTCGAGTGCCAGCATCAGCGCGTGCGTACCAAGTCGGCCGTGGCCCTGAGCCTACATCGGAGCAATATAGATTTGTA
AGTCAGCTAGCCCCATGTGCCACAGCGAACAACACCATACCTTGACGGCGACGTAGAGTTGATGCGCCAGCGCCAAGCCCGGGAGCGACAGGTTCATGCT
GCAGGCAGTGGAGCATCGGTTAGCACCTCGCTATAGATCCGAGCTAGCATTTGGTCATACTGGTTGTACCTCTCAGCCTCCTTGAGCGCGATCCCCATAT
CCTTCAAGAAATGCTCGACGAAGAAACCGGGGTCAAAGTTGCGGTTCGCGATGCGCGGACCAAGGTTGCTGATGGACCAGGAACCCGCCGCGCCAGCGGA
GACTGCCGCGATGGCCTCGTTCAGATCGAGCCCGGCCTTCTGAGCGTACAGCAAGCCCTCGACGACGCCGATCATGTTGGTGGCAATGAGGATCTGGTTG
ACCATCTTGGTGTGCTGGCCCGCGCCGGCCGCACCCATGTGGCGGATGTTCTTGCCCATGAGGTTGAAGAGCGGCATGGTGGCCTGAACCGTCTCAGACT
CACCGCCAATCATGATGGACAGCGTCGCGTTCTTGGCACCAACGTCGCCGCCCGACACAGGCGCGTCCAGGCTCGCGACGCCCTTCTTCTTCGCCTCGGC
GTAGATCTCCTTGGCGAGCGACGGCTCGCTCGTGGTCATGTCGACGATGGTGCCGCCGCGCTTGAGGTGCGACAGCACGCCATCCTGCGGGTCCAGGAAC
ACCTTGCGCACGTCGCTCGGGTACCCGACGATGCTGAACACAATGTCTACCGTCGGCATTAGCCACATCAGCCTCCTCCACCATGTCAACCACACGCTCC
CTTCCTACCGGAAGAAGCGGCGACCTCAGCCGGCGACTGCGCAACACGCGCACCCTTCGCCCGCAGCGCCTCGCACTTGGCCGCCGTGCGGTTGTACACG
GTCACCTCGTAGCCTTGGCTCTGGTAGCGGCATTCTCCGCGTTAGTGTCAAACCCACCGCCCCCAGCCTACAAACAAACAGTGGCAACCTACCAGGATGT
GGCCGCACATGCTGCTGCCCATGATTCCGGCGCCGATCCAGCCGACCCTAA