Description :
From Genome Similarity Track
Location :
Scaffold_1466:2770- 4572
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1466-snap-gene-0.6Major Facilitator Superfamily (MFS)
Pytul_var.sporangiiferummaker-pug3_contig_1466-fgenesh-gene-0.1Pyruvate kinase

Sequence
1802 bases(100 bases per row)
AGCTCCTGTAAGCGCCACACGTCGCCAAAGTACAAGAAGAGCAGGATGCTCAAGAACGGACCGATCACTTGCGCCACGTTGCTCACGTTGTACTTGATCN
NNNNNNNNNCGAAGCGCGGCGCAAATTGCGGACTGGTGTCAACCAACGGAAGCGCTACATCCCTGTCATGGCGCGGCCCATTCGGAGCTGCTCATGCCGT
TCGCGTACACACATCCGCGCAGCCACTTCGTCGGCTGCTNNNNNNNNNNTGACCGTCAGACTGCTCGCTTCGACGCCAATGAACGTCAGCAGCGCGCCGA
GAAGCCCAATGACGCCCGAGATTTTCAACACCGTGTCGCGCCGCGTATGATCCGCCAAATAGCCTGCGGGCAGCGAGAACGCCAACTGCGAGATGCCCTG
GATACCCTTGACCATGCCCACCGGCTGGTTCGAGTCAGTAAGCACATAGATGTATCCGGAGATCACCTGCTGAAACAAAATGCTGCACATTGCGCGCACA
ATCATGACACAAAAAGAAAAATAATGCACCGGTTAGACCTCGTTCTGCTGCACCTTCGTAGTGAGGATACATGAACGTAGAGCCGTCGGGTGTAGGTAGG
TAGGTACCTTCTGGCGGCCCAGTAGAAAAGCGTGAAGATGTACGTGTTCTTGACGTTGTGCGCGGCGCCGCGCGCGCGTGCAGCATCCGTGGCGATCCCC
ATGCCTTGTTGCTGCTCACACGACGACGAATTGCGAACTGCTCTGTGCGCGAAAAAAAGAAAGATCTTGAATAGGTGCGCGAGAGTGAAGGTCGTTAGTT
TCAAGAGCTCTTATTGCTTTGTATTGGTTGAAAAAGGAGAAGTACAATAGGTACGTGATTGGATAATAGTAATTGAGGGTACACACGATTGGTTGATATA
CTGGCGTGAGCGGACGGGTTGCAACGGCTCGCATGTTGCTCATATAACTATCGAGGGCATGGAACGGATGGATGCACGCAGCTCTTCGCCTCCTCTATGT
GTGTGTGTGCTTCCGGAGGTCGTTATACAATGTAATACCTGAAGCACGTACGTATCTGGCAGTGCGAGCTGCTCTCCACGTTAATGGCCACGTTGCTGTT
AGAAAAAGAAACCTGCTAACAAGAGAGCAAGCGCATTCAGCACCTTGCATGCGATTTGCCAAGGCGCGTTGCGACATTCTTTTCGTAATTGTATCAAAGA
CAAGAGCACGCATGCGGATATCATGAGAGCAAAGACGCGTTGCAGTGGCGTAGTTGCATGCGTGCTGAAAAGATACTGTACGCTCATGGCGTCGTACATC
GTCAGCAAAGTGCCCATTGATGTGGATGGTCATGAACACGCCCGCTATGAAAAAGCTCGATATACGTACGTCGAATAGATTTATTTGCAGTGTTTGTCGC
TGTTTTATTGTTTAATATCGCTACGTTAAGGCAGTGCTACAAGTGCGCGTTTACGCCACGTTTGCCACACGCATCACGATCTGGTTGCCGAGATCGTCCG
AGAGGTTGTCGGCGCTGAGCACGACGACGCGGTCGCCCGGCTGGAGCCAGCCGAGCTTCTTGGCGTCATGGATGGCCTCGGCGGTCGTTGGGCGGCGGTC
GTGAGCCGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGTTGACGGCCGATCTTCTTGTTGTTGGTGAAGCAC
ATGACTGGCACAGTCGGCTTGTACTTGGCAACCTTGCGCGCCGTGAAGCCCGTGTCCGTGAGCACAATGAGCAGCTTGGCGTTCATCTCGTGTGCCGTCT
TG