Description :
From Genome Similarity Track
Location :
Scaffold_1213:277- 4768
Transcript NameFunction/comments
Physo_145431reverse transcriptase

Sequence
4491 bases(100 bases per row)
ACTTTGGTGTAGACACACCAAAGGCTGCATACATTTACGATCACCACGACGGGTGGTTCATCGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTT
TAGCCAATGAGCGACATGCATAGCGTAGGAATGCTGCCAACCAGTCGTTGGCAGATTCCCAACTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGACCCGAGTATAATTAACTCTAAGTTA
AACTAAGCTACGCTTCCTCACATACACGCGTACACGTGTAAGCTAGAGTAGTGAGCCAAGGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCA
ACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCAGAGCTAAGAACCTTCCCATGGATAAGGAGGTGTCCATGAAAAGCTCCACTACGCCTGCA
ACTCACGTTGCACGCGCTGACTGTCCCCTCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTTAACAGTCATTGGTGAGGCGGCTGTAGCTACGAT
GCTGCGTACGCCAACGCCGACAGAGCAACATGGTGTTGCTCTGGGATTCATCATGAGGGAGCAGCGAGATGCTGCTTCGTTTACCACGGTGTCGTCGGGG
ACGGCACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCA
TTGCGGCTCGACGCATCGTCGACCCGTTATTGAAAGTCGCGTTCGCAATGTCATGTCTTAGCGGACGTGCAAGAAGTTGGGCGTATGAACGCCGATTCTC
GGATCCTAGGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTC
GACCTGCAGCAGGGCAAGCATGATGTCCATGCTCACGCGCAGAAAGCACGGTACTTGGTCTCGAACATTGTGACCAACCCGATAGACGAGGCGACCAAGG
TCGTCACGTTCATGAAGGGTCTGAGAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCTGAACGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGT
GCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAG
TACGACTGGCAACGGGTGCCATCGTAAAGACCCAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCT
GGATCTGGACGATAAGTTTGACATTGTATTGGGCACGCCGTGGCTTGCACGGCAAGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGT
CGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGTCTAATGCCGCTGTCC
CGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCAAGCGTCGGCGTCGCCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGATATCAA
CACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGACCTCAAGGGGCACAGATGACGCAGACGAGTCACACGCCTCAGCAGTGGAGGCTGACGCGAATCTG
ATTGGATCAGGTCTGGCCAATAATAAGAGCGAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAG
CCGACGCACCCTCTGTAATGGGGGTCTCCGCCAATGGTTGGCGTCGAGGTAAGGATGGCGTGTCGACTCCGGGAGTCGACGCTGCAAGCGGTGCGGACGG
TTGCAAACGTCCCGCACCGGAAAAAAACTTGCATGCTGTCGTGCACGACGAAGCGCCGGGCGACAAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATAAA
CCCGCCGGTGGTACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGGGCGAGGTCAAGAACCAAGCGGAGCCGGGCTCCCCAAAACAAGAAGACGGCGCA
TGCGATGGTCGCTGCGCAAGTCTCGGTCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCAAGACGTTCAA
CGTCTTGACGCGTATCTGTGCCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACGATGCGACGATA
CCGGCGCAGACGCCGATACCTCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCATGATCTGCGCGATGGATTCTATCAGA
TCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATACTCTGGGAGTGGCTGGTGATGCCGCAGGGGCCGAAGAACGCCCC
TCCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCAGAC
GGGATGAGTGATGTTGAGATGCGCAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGTGCAAGCAAAAGCTCTATGCAAACCTGAAGAAGTGCATCTTCG
GGGTGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGGAGGTCAGAGTGATCAATTAGTGGCTGACGCCGTC
GAACGTCAAGGAGCTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTG
AAGAAGGACGCCGAGTGGATTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGATGCCGACC
AAGATCGCCCATTCCACGTTGTGTGTCACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCCTTGATCGTGTCGTCTACTA
CCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTA
CTCGGAAGCAAACCGTTCGAGGTCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCATATCTCGCAACGGATGGCGAGATGGCTCTCAT
TCTTCGTAGAGTATAACTTCCGGGTTGAGTATAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGC
CGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAATGTCGTCACTGTTGGAGGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTC
TTGCTGGCCTATGGCTCAGCACCTTCTGACAATGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTAT
TACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCACCTGCGACTCAGGATCATGTATGAATATCACGATGCACCGACTGCGGGGCAT
TCGGGCCGTGAGAAAACATACTTTCTTCTCACGCGGGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTC
AACGTGTGAAGCCTGCGCCTTCTGCGCGGGCTCCCTTGCAGTCACTGCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGT