Description :
From Genome Similarity Track
Location :
Scaffold_1646:277- 3277
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1646-snap-gene-0.2Ras-like GTP-binding protein YPT1

Sequence
3000 bases(100 bases per row)
CGGTACACGTACACTCGGCCGTCCTGGCACGCCATCGCGAGCAGGGATCCAAACTTCGGGTGCGCCCACGCGATGCGNNNNNNNNNNCGTTCGAGTCTTC
TGGTAGCTGCACAATATGTTGCAGCACATGCGCACTCGGTGGCGCTGCGTTCGGGTCCGACGCNNNNNNNNNNNNNNNNNGGGGCCGTGGCCTCCGCCAC
GTCATACACGCGGAAGGTGCGGTCGCCCGAGCACGTCACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGTCCAGCTGAATGTCGTTGATCATG
TCGTTGTGCTCCGTGTCGATACTCGTGACCGGTGGCGTGCGTTGCTGCGTCTGCTGCGAGGCGTACTCCCCAGCGCCATGAACCCCCGCGTACTCCATCT
CGCCCTCCTGTATTCGGTCAAATTGATCTCTTTGCGTGATGCCTTTATGCTGCTTGTGAGATGGTATAACCGCGATTTTTTGAATAGTGGACTCTCTCTG
GAAATGCATGACTCAAAAAGTGTCTTACAATGGCTTGTGGAACAATCATGTAGGACGTCGTACATTGTCGTTCCACACTTATTTTATTTGAGATGACTTT
ATAGCGCAGTGGGTGTGTAGCTATTTTGGGCTTTTGAAACGTTATTGACAATTTTGAACAACCGCAGTGGCAACAGCAATGTTTGCGATCAATGGAGCAA
GCGGACCGACAAGCCGCCATGAACGCCGCGTGGTCACCGATGCAGAGAAGCAGCAGCGCACTGCGATCGCGAAGCACGACGCGCAAAAGAAAGCGGACGC
TTTCTTCAATGTGCGCGTGCCAGCAGCGCCCGCGAAAAGGCAGCTGAAGGCTTCAAAGTCGGCAAGCACATCCTCCGGTAAGACTACAATGAAGTGTTGC
GTTTGTTCTGCCTTGTTGTGCGCTCTGCTTTAACGCTATTGCCACTGTCCCATATGTGTGCAGGCACGGAGGGGAACCAGGAGACGCTCGATAAGATGAA
ATCGCTCATTTTCAAAGTAAGGCAAGCGCATGCATTAAGACATGCGCGGCTATTTATCAAGAGTCATAGTCTGCTGCTGTTCTTGTTTTGGGATTGCTTC
AATAGGGCTGTCGCATCATATTCAACGGTCGCACGGGAAAAGTGTCGTCGTAAGTTTCACGCAGGGCATCCTTCTTTTACTAGTTGGGTGAACAATGGCT
GGTCGAATGAATCTCTTTGTGCCGTTTTTCTCTGTTGCGTGCCAAATTAGATACTACCTCGCAAAACTGGTGCAAGATCACGGTGGTAGCGTATGGTAAG
AGGCGTCTCGAGGTTTCAAGCCGCTCTATCGGATGGATTCCCACGCGGAAATTATGCTCTAGCTCTGCCTTATCCGCGACTCGCGTGACGCACATGATCG
GCTCCAATCTCAGCGGCGCCAAAGTAGACAAAGTGCTCAAGGTATCTATGTTCATGCCTCCATTTGCAACTCATGCCACATTTTTGCTACCAAGTATATC
GTTGTCCCCCATCCATGCGCGTTCAGAAAGCTGGCAAAATCAAAGTCGTCAGCCCAGGTCAGCTTGCAATGCATCAAGTAAGATGTAGCCATGACTTACT
TGACGTCGCTCTGCCTTTTGTTCTTTTCCATCAGATTGGATTCTTCAGTCCGTCAAACTCCGGAAGCGGCAGCCCGAGTTAGAGTATCTTCTTTACAAAG
ATTCTCAACAGCAGCGGCTGCATCCATAGCCCATTGCCCTCCGCACGCACACACAGAGTAAACGAGTATTGCTCGTGTAAAGAAGAAAAACTGATTTTTA
TATTAGAAAGCGCACATAGCCAGACCAGAGCATTCTCTAGCAGCCGCTGCGCAGTTCCTATCTTGATTTCAGCCAACAGAAAAAAAAATGCAAGGAGAAA
AAAATAGAGTTTTGATGCTGTTCCTGTTTCGTTTCTTCGAATCCCATGCGCGCACCTCGATTTCTTTCTTCTCTTCAACCAAAATGAAGCTCTCATCGCT
TTTCTTCTCCACTGGTTGCTTTTCCGTCGAGTACGCATTGGCAATTGTACCCACTCAACCAAGAAAAAAAGAGAAAAATGCAGACGAAATGCCGACGACT
GACGTGGGAGATTCGTAGAACCGCGGAGAACCACAGCAATAAATCATCCGACTGCTTAGCAGCATTTTCCTCCGCCGTTCTGCTGCACGTTTGTGCCTTG
GTTTAGCTTGAGGGTGGGCTTTGGCGCAGTTGGGGCGTTCGCCATTCTCTTCTTGATCTGAGCCGCCATCATCATGAACGCCTTCTCAACGTTCGCAGCG
TTCTTGGCACTCGTCTCCAAAAATTCAATTCCAAGGCTTTCCGCAAATTCCTTGGCTGCCTCAGTGCTGACAACACGCTTGGCAGTCAAATCGCTCTTGT
TACCGACAAGGAGCTTGTTGACGTTTTCACAGGCGTATCTGTTAATTGGGAACAAAGCACAAGTCAGCACAAAAACACTTTATCTACAAACTGCATGGAT
GGAGTGTAACAAGGTCGTTTACCGGTCAATTTCGTGGAGCCATTGCTTGACGTTGTTGAAGGATTCTTGGTCGGTCACATCGTACACCACGATAATACCG
TGAGCGCCGCGGTAGTAACTGCTAGTAATGGTGCGGAAACGTTCTTGGCCAGCGGTATCCCACTACGCAATATAATAGTCAGCTCACATGGTCATCACGT
AATAGCGCATCAACTGTTCTCTGGCTTACAATTTGGAGCTTGATGGTCTTGCCGTCAAGTTCAATCGTGCGAATTTTCTACAAAAATAGTGAAGCACCAA
TTCTGTCAGTTTAGCTCGAACAAAATCAAATATCACCATATTTTTACAACAGAAAGGGTAATGGCCACTTACGAAATCCACACCGATGGTCGAGATGTAG
CTTTCCGTGTACGTGTCGTCGGCGAAACGGAGAAGCAAACACGACTTTCCGACACCGGAGTCACCGATAAGCAAGAGCTTGAACAAGTAGTCGCTGCACA