Description :
From Genome Similarity Track
Location :
Scaffold_1638:277- 1596
Sequence
1319 bases(100 bases per row)
ctacaccacaccaaTAAGAACAGCAATACCGTCAGTCACGCGCACTTGTTGTGATTGACACACTTAGCGTTGTGTCGTAGTAGAATCGACATCGACAAGG
GtttcgctgttgctgtgagCCTCGATATACCTTAGGACGGCGAGTACCCCGAGCAGAAGGTCAATCCCCTCTTCTCAATCGTGGCTTCCTCCGGGGCGAA
TGGAAATATAGTGGGAGTCTAAGCTCCGACCGGGTGGTCACTTGGACGTCCAACCCTCCCTGAGTAGCTTTCCCGACACCTACTTGAATAACACGGTTCC
TCCGAGGCTGATAGCTGTGTCTGCAGGACAGTGATCGACGGAGGATCGCGTGAGACGGCGGAGCTTTCTTGTGTTGGCCGGTAGAACGTCGTGCATGCGC
TTCTCTCCCcgaggaagcggaagcggtTCAGCCATTTCCCGCCTGCTTCGAAGTGGGATCGGATGGAGAGTTGGGACGTGTCGTCTACACGTGTTTTTTT
AATAAAGGTTATGTACTTTATCAAATGAACTACTAGATACATTTTATGCACATTGAAATTTAGCGACTATAAACTTAGAAAGTATTCACAGCTCATGCGC
GCCAAAGTTTGGGCGGCAAATCGTGCTATACTTATTTTGGCTTTCAACTACACACTTCAGCATTAATGCATACGTCAACGTGTAGTCTTTATAGGTACTC
TATTTGACCATACTAAAACGAACAAACATGCAACAAACAAATGAGCTTAGATAAATAGTAATCGAATAGACGTCCTAGGCGGGCGTCACGTGAACTACTT
TAACAATGGTGATGCGTACCAGAGGCAAACAATGTATACTTATCGATCTACATGAGACGAACTACGCAGTCAGCTGCGTAGGAAACCCCGCGTGTGGACT
GGAGGTGTGCCAGCTTTCGGGCCATTTCATTTCATTCCATTAGATAATGGCGCGAAAGCCGCCACACCGCGGCGGGCGAGCATCATCGTGACACCAGCGT
CGGTACATCATCGTTCAGAAAATGGACTTAACCGGTAAGTTATTGGTAAAATACTGTTTATTACCGCGTAAATTACCACTTCGGTACGTTGTACCATTAG
GTATTGTCCAACCAGCGGCGCACAACGCTTTACCAAACATCAAGTATCAATATTAGCAATCCAAATACAATCTAAAAGGACGCAAAATGCTCCCTTTCAG
AGTGTTCCCTACCACCAGAAACTGTATCACGTGTGATTTGTACACGTGTCGCGTCCCTATCAACCGCTCAAAGGGCGCAAaatgcgcccttttagaTTGA
ATTCACCTAACTTTGTATA