Description :
From Genome Similarity Track
Location :
Scaffold_3275:277- 1489
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3275-fgenesh-gene-0.0Gene of unknown function

Sequence
1212 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGACAGGTCGTTCCGTCTACGGCCTGGTGAACGCCGTGG
GTGGTGGTCCATGTACCAGCAACCGGCAGGGAAGGTCGGCATTGCCACCGTGCATGGCGCGGTGTGCGATCATCGCGTGAGCATCTTGCTCGATTCCGGC
TCGTCCACGAGCATGATCAGTCTCGATCTAGCGCGCAAGCTGGGTCTGAAGCTCTCGTTTAACGAGCGACTGAAGGTCACCGGCATCGGTGGCGTGGTCA
CGTATGTGACTTCCAATGCGGCTGTGAAGGTGACGCTGGGTCTGGGGATCATCTACTACCTGGATCTCTGGGCGGGCAACATCGGTGAAGGCATCGACTG
TCTGCTGGGTTTCGACTTCATGGTCCGGGCAGGTGTCCGACTCTGCGCCAATGACGGCTCAGTCCGCTTGCCAGACGAGGAGCGCGTTCCGCTCGCTGCT
TCCGGTTTCCGCCCGAAGTTGCCAGAGCGAGTCTCGGTGAACACTCAACGTGAGCTCTATATCCCCCAAGGGCGCAGCTGCATGGTTCCGATCATTTATG
GTCGCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGCTGCTCAGCGGCTC
GACCAAGCGGACGATGATTTCAACGCTAGTCTTCCACCAGCCGTGCCGAAGCGAGCCTACGACGCACCTACCAAGATCCTGTCAAGGGGCGAGGTGGTTG
TTGTGTCAGACCTTGCTGCAGGTGCGTCGAAGGCACCCAGCCACGCGACCAACCCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
GGCCTCACCAGCCACACAATTGCCAGATGCAAACGTCTCTCTACCCAGAACGGTCGCACCAAGCGTGCCTGTTGTACCGGCGAAGCTGTCATTGCCAGCC
GAGCTCACCGCCGAGGCGGGGTCTACAGGTACCGGTGTGGTCATGATGGCTGTTGAAGAGACCCGTGTCGTAGGCACCAACTCGTTGCACGTCGAACCGT
TCCCAGCCGCGT