Description :
From Genome Similarity Track
Location :
scaffold_129:27694- 28933
Sequence
1239 bases(100 bases per row)
AGCCCCAGGCCACCAGCTTGCTTGGGTAAATATACGATCGCCGGATTGAGCTTGTGACGTGCTGATTCCGCTGACGTTGCATGGTGCCACAGGAATTGCT
TCTGTAGGTTCTGGAGTTGCTTTTCCGCCCAGTCCGGAGGTTCGAAGGCTGCTGCTGTGAATAGCACGGCTGGAAGCATGATTACATTTAGGATCAGGAC
CCTGAGTTCGACGCTGGTGGCCAGATTTGTTGCCGTGGCCAATCGCCTCTGCACATTCCTGATTCGAATCGCCCAATTTGGATCCGTTAGCTCGCCCGTC
CCGACCGCGAACCCTAGATACCGAACTGTTTCTCCATGCTGAAGCACCGGGATCTCCTGGTACTTTTTCAGCTTCACTGTTGTGTTCAAGAAGATGAGCT
TGCTCTTGGTTGGCTGAATCCGGAGGCCTGAGAGTCGGCCAAAGACGTCGACTATTTCCATGACCCTCGTTAGCATACTGGCCTTTTCCAGGAAAACTGT
TGAGTCATCTACAAACGCCGAGAACGTGTGCTCGGCTGCCGGTGTTCCTGGAACTCGGAGGCCTTTGATTTGCTTGTCCTGTTGGATTGCTAACGCTAAT
ATTTCTGCCGCTAGTAGAAACAGAAGTGGTGCGAGTGGACACCCTTGCCTGATACCGGATACGATGTCGAGTGGCTCGGATAGGCTGCCGTTAATCAAAA
ATCGTGCTGTCGTTCCTTGATGTAACTTCCTGATCATTACTCCGAACGCGTTCGAGAATCCGAACTTTTCCAGTACTAGGAAGAGGAATGCTCTGGCCAC
TGTATCGTAGGCCTTCTTAAAATCGAGCATCAGGATCACTCTGCTCTCCAGTGCTGCTAGGTCGGGTTCTTGTTTTGCGGTTGTTAGCATTGCGAGCATC
ATCATGACCGTTTTCATCATTTGTCTGCCATGCACGAAGCCTTGCTGTGACTCTCCAATTGTACGTCCCATCACCTTTTGAACCCGGGATGCTATGATCT
TCGTGTAAACCTTATACCCGGTTTGGAGGAGAGAAATTGGTCTGTAATCCATCGCGTTGTCCGAGTCTCCTTTCTTCCTCAAGGGAATGATGAGCCCTTC
GAGGAAGGATTTTGGTGGTTCTCCTCCTTTTAGGAGCTCATTGCCGATAGCCACCATAGCTGGCACGAGAAGCGCCTGGGCGTCTTTGAACAGATCGTTG
TTGAGGCCATCCGGGCCCGCTGCTTTATGCCTGTTCAAC