Description :
From Genome Similarity Track
Location :
Scaffold_246:27693- 29247
Transcript NameFunction/comments
Phyke_g8151ABC transporters ABCA family

Sequence
1554 bases(100 bases per row)
AGCTGTGCACGCCGTAGCATTTCGTCCACAGCTAGCGCGAACGCTGTGGGTGGTGATAATGCGGCCCAGTACTTTGGTGTGTTTGTGTCTGCAGACTGAA
CCGCGAAAAATGGGAAGAAAAGAAtgagccacagcagcaccgaagcGATAGCGGCAGTTCGTGACTTGTTGAAAAACGGGGCGATAAAGTACGAGAAGGC
TGTGATGGCCACGCTGAGCGTCCAGAAGAGAAAGACCAGGGTCGCATACTCAGTCGTGGGGAACACATTGCCGTATTTGAGCTCAGCAGATATCGCGAAC
GCGAGGGGCGTGGCCAGCACTGCCGTCGTGAGGCACCACGAGCAGAGTAGTGTGGCGTCTGATAAGCCCATAATCTTCATCACCTCACGCAGTCTGTTTT
CCTTTTCAATGACCAttgtcgtcgtggtcgtggacaCAAATTTGATGTAGCTAACGAGAAAAAAAAGCCCCAGAACCGACTGGCCGCCCGTGTAGAACGA
CGTCATGGTCGACGATGGTCCGCCGATGGACTCGATGCCCCAAACTGCTAAATCGGAGCATATCAGCGTTTCATTCGCAGCGACCACAGCTGCTTCCGAC
GTGAACCACGTCGTTCTCCAACCTCCAGCAATGGAATCCAGGTTCGCGAGCAACAGTAGCGCCGTTGCTAAGAGCACTGGCAGAAAGAGTTCCATCACAA
GTGACACTGGTTTCCGACggcgcagcagcatgttTTTCCACACTAAGTTGGTAATTTGTCTCCACGTCGCAGCTACGCGAGCAGCGAATCCTGTGGCCGT
CGCCCCCActgcttgttgctgagtCTCTAAATGTTGCTTGCGCCGTCCATATAGTCTCGAAAACACAGCAACTCCTGCTACAATTGCTGCTAGAGTAACC
ACCACTACAGTCATGATCGTATCGGCCGACGATAAGCCCCCATCGCACTCGTTCTGGTACGTGAAGACACTGTCGAAGAGTTCTTTGCACGTTGTGACTG
CTGTTGACGAAGTGTTGCAGGACCGCAGAGACGCCGCGGCGGTACAGCAGGAAGATGACGCCGACGTCGTTTGTTTGGAGCACATGACGCGACAGGCAGA
GTCGCCATTGAAATTGTCATTATCGtctgaggaagaagaagaaaaagaggatgaggaattgttgttgttattgtcCTGGAAATCGTCTGGAACAAGGTCG
AAGAGCCCCGAGTTGGTCACGCAGAGACCGTAGGTGATGTCGTTGGCGATCACAGTGGTCACGCAGTCGGACAGCGCCGTGAGGGTAGCGCTCTCAGCGG
CGTCGTCGGAAGATCCGGCGTCTGCCATGCCAGTCACGTGGGGAATTCGCTAGTGAGCTGCAGCCTGTGCCTAGAGGTACAGTGGCATTGATTAAAATTG
TACGACCAGTAAAATGTGGACACGATTACTTAAACGTGAGACAGAAGTTAAACTCTACTCAAACGAGTATAAGTGTCATGAAAAGACAGACTCATTTAGT
AAAAAAGACCGTGACCTAGCACCGAAAGCAAAGCGATGAAGTAATCAAAAAACG