Description :
From Genome Similarity Track
Location :
Scaffold_284:27683- 32223
Sequence
4540 bases(100 bases per row)
GCTTCCTGATACCACCGTGCCTCGCGATCGTTGGGTCCCGGGGTTTGGAGATCGGGTTCCGCGATCAGAGGTGGACGTATCCACTTGGTCCGCTAGAAGG
GTCACCTCGATCAGCTTGTCAGTATTGGACATCGACTTGTTCTATCACTACTTCTCGAAGCCGAAAGGATATATATTTCCTGTCCAGCAGGGAAAGATTC
GCACTCCTCCAAAATCGTTTTGGTCATCCCAGCTGATCATGTCCACCAAGATCAACCAGTTTTACGATCAGCAACCGTCGGACGTCTATAATCGGACCGT
ACGCCCGATCTCGTTCGAGTCTTCCGGGTGGTTCGAAAAACTTTTTGACGCGTATCAAGGTTTCGTGGATTGTCATCGTCAAGCTCTGTGGAAAGCATCA
CATTTTTTGTGGATATCCCCTGCGTAGCGTAAATCGGATCCTGGGTTGGATGCCTTTGCGCAAGAAGGAAGGCAGAGACGGTACTCGTGCTATCCCCCGA
TGAAAAATAGTGTTGTAGCTGATCCTGCAGGGCATGATCGACGGTCTTTGCAATCTGGACATTTTACTGGATTCCATGTTCCTGCACTCTCCCCGTCCGA
ACGAGTTCAGGGTGTGCTATACCGACCTGTTCGTGCAGCGGACCAACATACCCAAGTTGATCACCGCTTTGTCGATCGATCATGCTGTTGAGCGTTGGAT
GAACCAGCTTTGTACGTCGATCGCCTCCAACCCTAGGTCATCTCTATCACGATTAGTTGGTACGTTCTTTGACCGCAGTTTATTTCTTTGGTCTAGTTCC
ATAAACCGATCTCTCAATATAATTTCTTCTCATTTCCAATCAATCGCTCCCATAATTCGTATTTCTTACTTCTTTTTATCGTCTTTTCATTTGATTGCAC
TAGTTGGTCTGCGATCATCTCACTCAATTCACATAAATTTTATTCTATCTAAATGTACAACCTCCTTGCACCCATAACTCTCCTCCACGTCCATGCACCT
TACTTGCATAGACCCATCCACTCAAGTTTTCCGATCATCGCTAATCTCTGGCTTCTTTTTTGTGCGATTGCATCACCTCAAAACGATTCCTGCTCACCCG
ATCGCGATCGAACTCCTGTAACATAGCTCCACAATTGAGACCAGCTTCATCAATCCAGGTTGGGTCGCTGTACTCTTTCCGTTTTACCAGGTACTGCTTA
TGTATTCGGCCATTTATAATCTTCCGTCCTGATCGCACATCGATAATCTTATCAACTTCAAATTCGTCTGCGTCAATATCACTCTCCTAACTATCTTCCG
TTAGCGGTGCTTCGTCAAAATTGATTCGACTTGCCTCATCCACATTCAACCTACTTGTCGAACGTTCTGGGAACACGCAAAGTAGCTTGAACTTAGAAAC
GTGAATCATTGGGAATAGCCGGTACTGCTTACCCGCGATTTCCAACTTTACAGCGTGATCGCCGCACTTTTCGGCCACCCGAAAAGGTTCATGTCATATA
TGGGCAAGCTTCCGAGCATATCCTTACTTGACTCGGTCCAGAGATAACCAAACTCGCTACCCGCGATCGATATCCAATAAATCTCGATCTTGATTATGTC
CATCGGCTCGCTCTTTGATCACATTCTCCAATATTTCACTCAATACTGCCCGTGCACGCTGATATTGGCGTTCTATGCCATATCTCCACCTTCGTGCGTC
TCGATCTCAGGGTTTAGGTAGTGCTTCCCAATGGTAAGGTTGCTTCCAAGGTCGATCTTGGGTCCCAACCGTGAATCAGGTAGAACGGTGTATCTCCTCG
AATTCGATCATGAGCGGTGTTGATCGCATAAGTCAATCTCTCTGCGTATTCGTCCCAGTCCTTTTGATTTTCATCCACAACATACATCTTGATCGATCGA
GTCAGCGTCTTCACCATGCGTTCGGCCGTGCCATTAGCTAGAGGTCTATACGCCATAATGGCCCGTTGTTTTTGTCTCGCGATCCGATTGAATGCTCGGA
AGAAATCGAACATAAATCCCGGCTCGCGATCATGGCGTATCGCCTCACCCGTACCGAATTGTCTGAACACGCACTCCTCGTAATTCTCTGCGACCGTCTG
GGCAGATCTGGACTAGCTTGCCTTTGCGATCACATATCTCGAAAATAATTCGAACCACAACAACAACTCGGTGTTATACTTAACAGGTCGTGGCAACGAA
AGGATGTGATCCATAGCTATAATCTGAAACGGGTACGTCGAATACAAATTACCAGGTGATCCGCTCCGATCCCCCGGCCGTCCTTTTCCCGTTTCACAAT
CTACACTCACTCCCACATACCGCTGCACAATTTGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCGTTGATAGGTACGGCCGATTCCTTGGTGACC
ACCCTCTAAACTTGTGTGGTAGTGGTGCAAGAAGTCTCGCTGTAACTATTCTGGGACCACCAAACGAGCCAGTTCAGTACGATCTTCAGCTTCGGTGGCC
GATCTCGGACAGAAGAATAGCTGCCCCCTTAGGTCTACTTCGTAATCTGGTGCGATCAGGGCGCAAACTTTGGCTTCAGCCGCCTTTAATTTAGCCACAT
CTCTACCCAGATATATCTTCAGAGTAGGTATCCAATATTCTTCGTCTAGTACTTGCTTAATGAGATCGATCCGTATCTGCTGCACCACCTCTTCCTGTAA
AATCCCGGGTTGACAGCGTCTTCTTAGAGCTGATCAAGTGGTGGCCGCAAATATGACTGCACAATCGAATCGTCCTAGTAATAGTAATGCACCCAACCGA
TTATTAGTAATCAGATCCTGACGATCCTGATCCGAAATCACAACTGTTCCTTTCTCTTGCCGTAGTGCTTGACTCGCCAACCGATCTGCACTCTGATTTC
AATCACGCCTCATATGCAAGAATTCATGGTCTGGCCACGATCGGAGTTTCTCCACCGCTCTGTGTCTCAGCAACTGCAGTCCTGGTCCCCTTACAGTCGA
TTTCTCCTCGTATTCGGCAGACCCAAAAATTCGAATCTCCGCAAATAGTCACTAGCCGCCTGGCCTGACTGTCAAGCAAGTCGAAGCTGAGGAGCAACCA
TCGGTATTCTGCTTCATTCACGTTCAGATCAGGGGTAAACTCGGAAGCAGCAGCCACAATCGTCCACTCCGGCAGCTTTTATATAATCGTGCTGTATGCT
CCACCGTTTCTTTTCACCCTGGCTGATCCATCGAAACTGGCTACCAGCAGGTTTTCATTCACACCTACTGTGGGTGGTGGCATGCTTATCGTCTGTCTTG
GCTGCTTCCTGGGGGCGATCGAAATCAACACTTTCATCCACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATGCCGAGTATTTCATCTTCTCCCTTCT
CAGCTCGCCTAATTTCCAACGTCCAGTTCGATAGTAAATCAGCCCATCGTCCCAATCTTCCGTTTAGGCCTGAAGGTTGTAACTGCCATGCCAGTGTGGA
ATACCTTGTAAACACTGTAATCTCGCAGGATAACAGCATAGTATAAAAGATATCTAGCATCTGGAAGAGAGCTTACACTTCTTTCTCCACCATCCTGTAG
TTGACCTCGTTGGGCTTTAGCGTACGACTGGAGAAAGTGACAGGCCAATACACACCATCATATTCTTGAAGCAAAGCCGGTGATACAGCCCACTTACTAG
CATACACGACAATCACTGGCGGTCGATCGGGATCGAAATGCTTTAAGATTGGAGTTGTGGCTATCTTAGCTTTTAGCAACGTGAATGCAATCATTGACTT
CTCCCATCGATTCCTGCCCTCGAAATCGCGATAGTCCCCTGCAATTGGGTACCGATAGACATCGATCTCCGGTTTTGGGTACAGATCACGATCGCACCCT
GCACCTTCTTCGTGAATAACATCTGGTCTTACAGCAGAGGTAGGTTTTGGAGCTTCACTCACGCGGTTGATCTCATGGAAATATGCTTCGCGCAGTTCGT
ACATCACTGATGCGTAGAGTGCGAAGTCTTCAGTGAATCTACTGTAATAGTTGAGACTTCCCAAAAATGACTGCATCGCTCGCAGCGTCCGAGGGAACGG
GATGTTCACCAACGATCCCAGATCTTTCGGATTAGCTTCCAAACCTGCGAGCGAGATTTGATGTCCGAGGTATTCCACCTTGCGACGTCCCCAAAAATGT
TTGGCCAAACTGATCGACAAAGTCCACTTATCGCACACCTCCAATAATCTCTCCAATTTCTCACACAGGGCCTTCCACGACGTAGCTGGTATTAATATGT
CATCAATATAAGACCTTCGACCCAATACCGGTGGTTTCGGACCGGTATCTGGTTCACCGTCGGTGAAGACATCGATCAACTTTGGTGATCCGGCCGTGAT
CGACTCGGATCTTGCGCCTATGTTCAAGTACCCGTACAGATCGTTGTCGATCAAACGTTGGTAGATCTGTGGAGCGTTTTTCATCCCGAAAGGCATCCGT
AACCACTCAAACTACCCTGATGGTGTGATAAAGGCGGAAA