Description :
From Genome Similarity Track
Location :
scaffold_12:276817- 278807
Sequence
1990 bases(100 bases per row)
GTGTTGACGAAGGGTCAATTACGGTAATCGCTCGCTCGGAGGTGCTCACCAGCTATGCAAATGCGCTAGTGAGACACCTCAAGAAGCCCACCATGGGTGT
CGACTGggcaaaaataaataaatctcAACCCGAGAGCGCTACGTTGAGCTTCCGAGCTTTGAGGCCGGAACAGAGACTATATCAGTCTGTTGATTAGTGA
AGTTTAAATGGCCACAATTTTGCTCTGCTCCGAGTCAAAACAGCGTGTCGCGCCAAGCTAGAAAAGATCGCGCAGGGAGGGACATTGAGGTGTACTTTGT
CTGTGAAAAATGCTCCTCTCACATCAGAAGATTTAAAGCAACATGTTTGCACCACCTAACCAAAGGTAGAGCTCATTCGGGATTCTTGCTCACCTATGAG
TTGAAAACTAGTAATTACGCCCGGGAATTATGTAGTCTTGTCGCCGCAATGGTGATCGAACCTCTTGCAAAATACTAATCATCGTCGTGGAGAGGTTTCA
AATTGGTGAAGTCCGCACCAAAACCTTCTGCAAATACCCTCTTATCTGAAAAGTAATTGGCATGCACTTAATACGGAATACATCTTCTGAACCGCAAGGA
TCAGAAGTTATAATGAAGGGCAATCTCTATCGCGACAGCATCGGTCACTTGATACACGGGTGAAGAGTACTCACCCCAGGAGCTTCAATGGTCCGCACGT
TGGGCTGGTCACAAGGAAGCAGTAGTTTACAGTATAAAGGATGAGTTATTTCTTTCAACTTCACTTGAGAGCTGCAACTGCCTTGTCAGGTGCAAGAGAA
TCATTTCCCACGCTTTACCTGCTATGATCAGGATACACAGGCATTAAGCCGTTTTTGGCCGATGAACAAAGATATCCACAGCAAGCGGGATTTCTACCTG
AAACTCAGTAGCGATACACCGAGGATCACGATAAAATACCTCCTTTTACTGCTTCTATCCAGCAAGCTTGATCCACCGCCTCTTTTGCCTTAAGGCTCTG
CCCCACGCACTCCGCAATTTTATTGCTAGGCAGTTCGGCAACTGCACATGACCTGTCGTAGCTTCGTTCCCGCCTTACAAGCAAAACTACCTTCTTGCAA
AAATGATTCAAAAGTCGACAAAGGCTTAGAGAGAAGTTCATTGCACCTTACCGTATTAATCCGATAAGTTTGTGGCTCATGGCGTTCCAACACCGCCAAA
ACTAAGGTGAGATCATACTTCAAATTTATGGGAAAGcttcacgctgtcaaagtcgtTAGGCTTTACTTCAGATCTTAACAGAATCCATGACGTATGTACC
GGTGTCCCCGTCGCAGGAATTTTAGATATCTTAACGTATTCGGCATCATTACTGCATCGACACACTGTCCACTATTTCTAACGGTTGCGCTATTTTTGGA
CTTTTCACGGCTCTCAATGCCCGACCTTTAATTTTGGACAACTTCGAGCATTAAATCCTTCTAGAGCGAGTAGCTTCTCAAAATGACGTTTCCCGCGATG
AAACTGTCGGGCGACCATGCTTGACAGTCCGATTCTATGTAATTTCAGCAGAGTACAAATGGGGCACACAAAGAGTATATATTTTATATAGAAAAAGCAT
CTGCGAGTACCGCGGATCTCCTCAGTAGATAAGCGAAATTTTTCACCCTCTACAGCAGCACAAACGTCCATCGCGCTGGAAGATCATACTGAGATGAAAT
AATCATTCCTATGGTGTGATTGAATAGGAGTGCAGGACAACAAAGTCGCCAAAATTGAATGTTTGACAAGAGCTGTACATATCAGCCCTCCTGTATGAGC
CCATTTAGAGCGCTTCTAAGTGTATAGAGGAGGATAGCTATCTTCAATGattgaccttacgttctataccagaaccagtacgagtggagtggatcgcaac
ccgcaaCCTCCAAGAGTGCCCAGAGCCCTAATCAAAGCAAATGCACtctatttttcaaaattaaaactgtaaTTTATTGTTTaagctgcg