Description :
From Genome Similarity Track
Location :
Scaffold_1340:2768- 3774
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1340-snap-gene-0.2Sodium/glucose cotransporter

Sequence
1006 bases(100 bases per row)
ATGTCCGTGCCGGAGAACAAGACCGACGCTGCGTACCCGGTGCTGCTCACGAACCTCATGCCGCACGGCGTGATTGGACTCATGGTGGCGAGCATCATCA
CGGCGATGATGTCGAGTCTCGCGTCCGTGTTCGCCGCGGGCTCGTCCGTGATCACGAACGACATCTATCTCAAGCTGCGTCCGGACGCGACCCACGACCA
GCTCATCTGGGTCGGCCGCGCGAGTACTGTGTCGTTCGCGGTGCTGAGCTTCTGCTGGATCCCGATCCTGAACGGCGGCGACGGACTCTACAAGCAGGTT
GTGGAGATTCAGAGCTACTTGACGCCACCGATCGGCATTGTGCTCATCCTCGGCGTGTTCTGGAAGCGCGCGAACGCGCAGGGTGCGATCACGGCGCTGC
TCTGCGGCGGGTTCCTTGGCATGATCCGCCTGATCTTCGTCACGATCGAGAAGCAGAAGAAGCGTGGCAAGTACCCGGAGGCCATCAACCAGTTCTTCTA
CATGAACTTCCAACACTTTGCGATCCTGCTCTGGGTCACCTCGTTGATCATCTGCGTCATCGTGAGCCTGTGCACGGCGCCACCGAGCACCGAGCAGCAG
AAATACATGGCGGACTTCAGCACGATGTTCAAGCTCGACGCGAGTGAGCTCAGCAAGCCGCGCTACGTCAACATCCTGGTCGCGGCAAGCGGCGTCGCGT
CGCTCGTCATCACGCTTAGTCTGTGGATTTACTTTGCATAGGAAGAGAGAAAAAAAGAAAGAAAGAGAGAGGTCTTGGAGGACTTGGGTCTGTCCATACG
TTGCCGTCTTTCTTTCGACGCCTGCTGGCTGACCAACGCACACTTGAAAGTAAATATGTAACTCATGTATTAAGTCTATCTCAAACACCACTGTGTATCC
TCGTCGTGCGGCTTGCTTCTTGAAGCCCACAAACAAGCCCATCGAAGCTGCTGCTGTTGTTGTGGGGTGACGGATACTAATCCGTCTTGGCAGATTGATG
AGTCTT