Description :
From Genome Similarity Track
Location :
Scaffold_141:27675- 49789
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_141-snap-gene-0.15Regulator of chromosome condensation (RCC1)
Pytir_DAOMBR486maker-pir_contig_141-snap-gene-0.16Regulator of chromosome condensation (RCC1)
Pytir_DAOMBR486maker-pir_contig_141-fgenesh-gene-0.10TRNA (Guanine-N(1)-)-methyltransferase

Sequence
22114 bases(100 bases per row)
GCCAGCCCCCGCGATTGCGTCCGCTACCGGCAAACTACGTGGCGCTCTGTGACACAGTGAAGGCTGGCGACCCGACAGGCGGTGCCGTCACAACAACGAC
GGAAGAGATCAAAGACGCGCTGTCCAAGATCCTGGAGTTCAGCCACGCGATCCGGTATCTCCCGCAGGGTACGTGCCACCCGTAGTTTTCATTCTGGGAT
ATCAAATAGTATGCAGTATTGGAGAAATCTGACAATGGTATATATATGCTTTGTGCTTTGGCAGAGAGCGAAGTTAGCGGTGCGGTTCCTTCACAGAACC
CTGATCAACAGATGCACGAGATTGTCAGCTCGGTCGACTCGGTGAACGACTTGTTCCAGTACATTTCCAACTTGGCCGCGACGTCGATGGATCATTGCAA
TCGAAGTGAGGCAGAATCGCTGCGTCAAGCTGGCGATTCCAGGAATGAACATGGTGCTGTGCCAGGAATGTTTGATGCGCGTGTTGGAAGTTACGTGAAG
AACCTGCAAGGGGTCTACCAGCTCACGAAGAAGGAGAAATACCGATATGAGCAACGGCTTTTGGCTGCTCGCGCTCACGCGGCTTCCCAGCGGAAGGTGG
CCCCGCCGCCTTTGCCACTGCCGACGCAGAACTGCATGACGATGGGCTGGGACTTGGCCGTGTATTTGCTTAAGGCTACACGAGCCGATAATCCTGACCA
CTACGTGCGAGCTCTGCAGATGATAAAGGAGAACCTGCTGCCGCTCAAGCCGACGGCGTACTCCGATAGCATGTATCTTGCTCCTTCAGCTTCAACGGCA
TTTAACTTGTTGAGTGACTGTTTGGGCGAGCTCGTACACCCAATTGAAAACAAGTCGATTGAGACGGAAGAGCGCCTCGGAGCATCCACGATCGAAGTGC
TTGCAGAGGTCGGCATGGTGCGCGGCTCTTTAGCGACGGTGCTGTTTGTCGTGTCGTGGCTCATGAAGCAGCCACCGTCAATGTGCGTAAATATCAGTTT
GACGCTGTCCAAGCTGGCAGCGTTGAAGGAGCAGCCAATGTATGGGAAATGCGAAGCGTCTGGTGAGCTTTACTGCTGCGGACAGAACTCCTACGGCGAG
CTTGGCGTTGGCGATGACATCGAAAGGCATCAGCTGACCAGTGTGTCGATGTGTGGCTGGGACGACATTCGCCAGATCGTGAGCGGCAATGAAACCCTCG
CGATTCTCACAAACGACGGCGTTGTCTTGACTTGCGGACTGAACAAAAGTGGGCAGTGTGGTCAAGGTCATTTCGACGAGCGGGTGATGCTTCCTCGTCC
TATCCAGGCGCTGCGATCGCAAAAAGTCAAATTTATCGCGGCGAGCAATGGCTGTGAGCATATGATTGCGCTCACGGAGACTGGATTGGCTTATTCGTGG
GGATATAACGACCGCGGTCAGCTTGGACATGAGAATTTAACGGCGAAGATCCACATCCCGAAGCTGATTGAGTCGATGAAGGACAAGAAGCTTGGGTTCG
CCGCTGTTAGCTATCACCACAGTGCCTTGGTGACTGACACTGGCGAACTCTACACGTTTGGTATGAATGATTGCGGTCAGCTAGGACTGGATCATACCCA
GCACCAGTCCACGCCTCAGCACGTGAAATCCCTGGAAGGTCATGAAGTCACTATGGTTGGTTGTGGACTCTACCACACCATAATCTGCACCGCCTCGGGT
GAGCTTCTTTCGTGTGGCAAGAACGATTACGGTCAGCTCGGCTTAGGTCACAGTCGTCAAGTGAAAGTGCCAACACTTGCTGCAGTGCCAAACGAAATGA
TTTGCTTCGTCGCTTGCGGCTACTATCATTCCATCGCCATTAGCACAGCCGGGCGGGCGTTCTCGTTTGGACGAAACGACTATGGACAGCTTGGCATCGG
CTCCAAGATCCATCAGAACATTCCGAACGTCGTAGCATTGTCAGCAAACATGCGAATGATCCGTGGTGCGTGCGGGTGCTACCATACCGTGTTACTGTCC
GAGCAAGGTCAGGTATTTGTGTTTGGCCGAAACAACAAAGGGCAGCTCGGCAACAGAGGAAGCGCAGACTCCCTCCTACCGGTTCCCCTCAAAGTTCGCC
CAGAGAAGAATTCTCGCCGCTGCATTGATGTGGCTGCAGGATTCTACACGACGTCTCTGATTGTCGAGCGTAAGCGAGAGAACGATGACGGCGACGCCGT
GGTTCTCGATCAGAGCTGCATCGTATCTGTTTGTGGACGCGTGGATATCGATCGATCTGGTGAAATTGAAGGACTGAGCAACTTCGGATCCATTTCGACA
GTGGGGGTGTCACTTTTCCAGGGGAAATGGTTTTACGAAGTTGAAGTTGTGACAAGCGGACTGATCCAGATCGGTTGGATCGACGGGTACTTTCAAGGAA
GCTCTGATCAAGGCGAAGGAGTCGGAGATCATGCTCACTCATGGTCGTACGATGGTAATCGTCAGCGAAGATGGAACAGCGGGTCGTCGTCGTATGGTGA
AAAGTGGAAAGCCGGCGACGTTATTGGATGTTTGCTGGATTTAACGACCTGTGAAATGACATTCTTCCGTAACGGCATCAACTTGGGTGTAGCGTACTCT
GAATTCAAGTTCATCACATCGGACAAGAAGTCTGGGCTGATGCCTGGAATCAGCTTGGAGCGCGGGGAGATCATTCGCGTCAACCTCGGTCACCAGCCAT
TCGCTTACCCACCAACTATTGCGAACGACTTTGACAGCATTTCGAGAGCTATCGTCTCTCCAACGTCCAGTGCTGTGCTGAAGGCTCCAGGTCAAGGTGC
TGCTGACGCATCCAGTTATCCTCCAACGCTCGAAGGCTCTGCCTCGGTGGTGGTCAAGAACATGATGTTCGTCGTCGGTGGAAGTTTCGTGGAAGACGTG
AGCGGATCTGAGCATGCGTTGAACAACCAAGTTTGGATATACCATCTCGAAAACAAACGCTGGGAGAAGTGGACAGATTTCCCCATCGGTATCCGTCACC
ACCAGGTTGTTGCCATCGATGATGACCAGATTTTAGTGATTGGAGGGGAAAGCAACACTCCGTCATCTCGGCATATGGATCTGTACAAGTGCTCAACGTT
GAAGAACGTCGACGGGTCACTTCCATCGTGGGAGCTCATTCAAGGCTCAATTGGTGCAGCGACGTCACTACCGCCACCGCGTGCATTCCACACAGCAGCG
TCTATCCGAGTACGTCTTGACTCGATGGTGTTCCTGTACGGAGGAAGATCAACTGAGAATGAAATGCTGGGCGACGCCTGGTATCTGTCTCTGGACGATT
ACTCGTGGTCGCGTCTTCCAAGTTCGCTATCACTAGATCCGGGTCCAAGAACGGGTTGCTCGTCGTCAGTTATTGGGGAGTGCGTCTACGTGTTTGGCGG
TCAAGACAAAGAAGACAAGTTCCGAGCGGATCTCTGGAGGTACAACACGTTTGATCGCCAGTGGCATTTATGCCACGATGATAACATCTCCAGCTTGCAC
GAAGCTGGCAGTGAGATTTCGTCTCAGTCTCGCAGCGAGTTCAACCCTTCAATGCCAGAATCCCGCGTGAACTATAGCATTTGCTCCGACCTTGGAAACG
TGTGGTTGTATGGCGGTGTGAATCGATCGGGTCAGTATCTGAACGACTTGTGGTGCTACTCGACCACATCGCAGAAATGGACTTCAATCGAGCTCAGTGC
CGAAGAAAACGTTGAAGGATGGTCCGGTGCAGCGTTGTTTGTCATGTCGGGAACGGCGACCGCTTTGTATAGCGCAACCGATTCAGTTCAGTCGCCGCGA
GCGGATGGCAATCTGCATCTGTTTGGAGGCAAAGTGAAGATTAGTGGTGGCGCGACTGTGACGAACCAACTATGCACAATCACGACCTCCGATACTTCGA
GAGCGTACAACGCAGACTTGACGAAAAACGTCTCGACTTCTGGAAAGTCGACGCACATTTTGGGCACCCTGCGTTCGAAATGTGGAGCAGGAACGAGCAA
GACGACTCAGCACTGCGTTCACGAGGCACTGGACTCCGCGATTTGCGTGCTATCCCACTTGGATAGACTAGCCGGAAACGACATCCCTGCTGAAGACACC
GAAACCATTCAGCTCTCACGCTGCACCTACCGGTCGCTTTGCATCGATCCCAAGGAGAAGACGTTCTCTGCGTTGCACCTCCTGCTGGAAAGCATCGCTG
CCAAATTTATGAATATCGAGTCGCTCGAAGAACTAGCGATGCACGGCGACTTTGTGGTGCAAATTTTGTATCCACTTCTCGTGACAATTCGGATTTTGAA
GCTGAACTTCTTCGAGGTGAGTGGATGGAATGCGTTAGGCTGGGCTGTTTGGACGACTCGAGTCTGATTGCGTCTTTGATTCTTTGCTGTTTTTTTAGTT
GTCCCGTTGCTGCCTAGATACTACCGAGATCGGCTTGTCTTCATCAGCGACGAAACAAGGAGGTATTCTTCACTCGATCCGCGAACTGCTGTTCCGAATT
GCAGAGCACTCTCCGAAGGTTCCAAGTTCAGGAGAGGTCTCGTGGTTCTATCATGCTGTGAAGCAGGAAACAGCCTCGTCGATCTACTATGGATTTTCAA
CCCTGTTTCCGTCTTTGCTCGATCGAATCCAAGTCATGAATCGATTGCTGGAGGACACTTCAGCTGATCAAAATGACTGCTCTCCGACGAAGAAGCTGTT
AGTCCCGATGCTTATCCCCTGCTTCACGTCTGCGAAAATGCTCTTTCAGCTCATGAACGAGTCTGGTCTTCTGTTTGAAGAGGGCTCTGAGACCACGCAA
GCGTCAACTTTGGTCATTGTCAAGTTCATGGACACGCTGCTGGACGCTCTTTGGAAGCAGACTCTTGATCTCCTGGGGAACATCGACGATCTCGGCAAGA
AGACATCTGTTGTGAAAAGACTTGAGGCGCTTGAGAGCAGCAACGAATTCAAGTGCCTCAACGTGTTCCTTCGAGCTGCCATTTATTGGTGCTCGCAGTA
TACGCGTGATGGATGGCATGTCGTTCAGTCGACATGTTCAAAGTTCGTGTTGTTCACATTAGAGCTCATGCAGCGTGCTTCGTTGCTGCCACCAAGTCGA
GTAGTGGCTCTCCCGTACATTATCCAGCATACATTCCCGGGCAAACTACTTCCGTTCACCTTGTTGAGCGTACTTTCGTTGCCGGCTGTTCGTAAGCAGC
TACCGTCCATCTTGGACGAGTTTTGGTCGCAGTTGGAGGAGCTGTCATCGGCAACTCATCTGGTTCTGAAGACTCTGAGTAACGACCAAGTTCTCCAGCA
ACACAGAGTGGCAAATCTCTCCCAGCCTGGACACCAAAGCGAGCGAAGTGACCATTGCACGAAGTTCAGTCTGTCGCAATCAGCACACGTCTCGGCAGAG
TTGTCAAGCTGTTTGTCGCTTCCGTCGGATGTTGTATTCACATACGGCGACGTTTTGAAGAGCATTTGGGCAAAGGCAGTCAGTAGCCCAAGCTTGAAGA
GCCTCAAGGTGTATGACGGCCAGAACGGCACGGAGCTGCATAAGTTCTCAATTCCGTCAGACTTGACGAAGTTATTCGGAACTGAAACACTCCTCGTTGA
ATACTCCAGAGGACGGGATGGGGCTGAATTGCGAGAGTTGGAGTTCGACGCAGAGAAACTCTCATTTAATCCAAGTCGAACGATCTTATCACAACACGTC
TACCCACCGTCTCGGAAGGAGCCAGCCTCTCAGATACTGGATTCCAGCACATTTCATGAAGCGCAGGATAGAAGTTGTCCGAACACAACAGATGTCGCGC
AGCAGTTGAAAGTTTCCGATTCAACACTAAAGGAAAGCAGGATGTGGCTCCAAGACCTGCAAAAGATCCTGGTCTGGGTAGGCAGTCATTACGCGGCAAC
GTTGGTAAGTGGTGCTGAACACCAAGTCGAGTATGCTGTGGATTCACGTTGGGCTGCATCTCCGCTGTTCCGAGGAGGATTGATGACCGCAAGTACCGAT
GATGTTGCTCACCACGGCTTTGAAAACGGAACTGGACGAAATGAGCTGCTTCTACAGCAGATTATCGACAATGCCGGTCCTGGAAAGAAATTGGTTGAAA
AAGTACGAAACGTTCTTGACCCCGGAGCAGGTGTTGGGGGCAACAACCTTCATTTGAAGGCAACTCGGTTGAAGCGCCAAGACAGTATCGACGCGGCAAT
CGAGAAGAGTGGTGGATATGAAGCCGTTGACCGTGCGGTGCGGGGGGCGTTTGCAGTGCTCTTGAAGCACAGCAACGTGTACTACATGGCTGAACCGATG
TCAAAAGAGGGAGTTCCTTCAGAGGCGGTGGTAGATGCATGGCGATCAGCCTTACAGCTTCGTCGATGGTAAGTCAACGACGGTGGTGGAACAAATTCAG
GGTCTGAGTGACTAACCTGTTTCTTTTTGTTTTGTTGCAAACAGGATCGTCCGAGAGCAACAGAAACTTGCAGCTCTTTCCAGGTTTGTTTGGTTTGTCT
TACTCAGAATTGCGCAGACATGCAATGTGAACTAAAGAAAATGCTGTATCTGTAGTGAGAAAGCTGGAACAGAGAATTTCGGCCCAGAAGCTCTTGCAAA
AGAGAGACAGCAGGCGCTCTACAACACAGTTTGCGAGCCTATTATCTGTAGAGCGCAGCTACTCCTTCGGTTGTCACCAGCGCCAATCGTCACGAGTGGA
GCTTGTTCATCTCCGCTCAAGCTACTACCAGGAATTTCGTCAGCTCCACAATATGGTAAGGATTCACAGCACTCATGATCCAATTTCCGAGTTTTACTTT
TAACTGACGTACGTTGAGCATTGCTAGATTTCTCCAAGGCGAGCGGAGAGATGGTAGCTGCTGCTGCGACGCCGGATTCGTTGAGTGATGAGCAATCTGC
TCGACAACTGAAGAAAATGATGCAGACGAAGTCAGTCGAGATGATTGAAGAGGAGGATGAGCGTGTGCAACTCGACATCTTTTCATTTCTGCAACAGTCG
AACAATCGTGCAAATGGCCAAGCTGAAGCCGAAGCTGGACAAGTGCAGAACCGAGATGATCTGATGAAGATGGCGCTTGAGGCTCACCAAGACCGTGCTC
AAAAGCGCTTAAAAGGCATCAAGGTCTTTCTTCGACTGCTGGCATGCACCGAGACGATTCCGAGCTCGAGGTTTCACATTATCCCCGTCCTGTCGTCGGC
ATTCAAGAGATCAAGTGTGAAAGACGATCACGACAATAGTCATGCGACTGGAAGTTCGTACACGGTGAAAGTCCACTATTTGCAAGATCTGGAGTTCTCT
GGCGCGAGATTGTCTGCGATGATTGGCGACGAGTTTTTCAGTCTCCTCTCTTCGCTCCTTGAATCGTGCGTCGACCACTTGGTCCAGATCAAGCATCTGT
TCGAAGCACCTTCAGCGCAAGGCGAGCAGAAGCCTACTTTGGCATTGCTGCGGCGTGCTATTCACGATATGCTCATGGTGCTGGACGTGTGCTGCCTGCC
ATACAGACCAAACGACTGGGAGCACATTGAGCGGCTCAAACTTACGTCGCTTCTGACGGAGCTGACAAGCTGGAGCGGGTGGAAAAACTCGATTCAGTTT
GACGTTTGTGATGATGCGAGCACCGATCACAGTCAGAACGAGAAGCTTCCAATCCTCCCTGCTGGATCTGGCTCTAGATGCCCGAAGATTATTTGCTCGC
GCAACGTCACGATTGGCACAGACCTCCACAAGCTGACGCTTACACACAAGGACAAGATGCTTTCTGAAGGATCAGCTGGTAGCGCAGAGAGTGCTGGTGG
GCTTGCGGTATTTGACAAGGCATTAAGTCGAGGACAATGGTACTGGGAAGTATCCGTTCGCTCCCAGAGCGACTTTCCTGTCTTTGTTGGTGTCACGTGC
GGAGCTGCCGACCTCAATATCTTTGACGAGAGTAGTCCGCACGGGTTGTACCTCCACAAAGACTTGACCCACGCGAAGCAATCGACCAAGTCAGGGGTTC
GCTGGCGTGGAGGAGATGTGCTGGGGGTGCTGCTGAACTGTGACGAGCGGAAGCTCGAGTTTTTCAGCAATGCAACTCGTGTGTTCAGCATCCCCCTTGG
CGCGAAAGAAGTCTTTCCGCTCGGATACTTTCCTGCAATTGCGATCAGAGACGCCGAGGCGTGCCTGGATCTTTCAGCTCCAACTCCTCCCAAGCTCTGG
TCTCGCACGAATGGGTTCCAGTTCCCCACTGCTGTAGTATCAGGCGGGCTTATCGCCGCTCCAATCGAGGGATCTACAATTGGCTGGGATGGGAAGCGTA
AAGGCCGTCATCTGCAAGTGTCTTCAGATGCAACAGCGATTGTGGCTGGGGACTCTAGTGGCGCGAAAGATCACGTCGAGACCATCGTTGCATCTCAAGG
CTTCGACTGTGGTATGATGTACGTTGAAGTGCATATCTTGTGCCCTGGAAAAGACGGTCGTGTTCATTTGAGCTTCGACATTGTCGGAAGCGATTTCACC
GGCTTTGAGGATGCATCGCGAAGCAAAGCATCGATTGAATGGACGAGTATGGAAGAGGCTGGGACCAAGAACGTGCTTGGAGTGCTCTTCGACTTTGAAA
ACGGGAACGTTACACTCCACACCAACCAGAATGAGCCTGCGGTCTACAACGTCGACCTTGCTTGTTTGAAGAAGCCGCTTTATCCTGCTCTCTCCGCTTT
GTGCAATGGCACTGTGGTTTGTACCAACTTTCACCCACAGCCGAGGTCAGAGCTTCCCGCGAGCGCGTGCTGTCCAGTCGGTCAGCGCCATAACTACAAT
TTGACTTCGTCAAACGAGCTGCAAACCGGGAAGAGTCTCCAGCTTCAAGTGCATTCATGCGATGGTGGAGAGTTCAGCTCATCGCACTCTCCAAAGAACA
GTCTGCTGGACGATTCTTCGGTCTTCAGCTCCGCCAAGGGCTGCAATGTGAACTTGGTGCTGAAGCATGAGATCGACACACCTTTTTGTCTGAGCTACGT
CACCATTCGAGGACCCGGACCAGGGTACTCTAGTCCGGTTAGACATGCGATCGTGTTTGTTACGAGCAGCCCGCCGGATCTCAAGTACTTTCAGAGCTTT
GACGATATGACACCCGAAGAATTCGCGTCTCTGCCATTTCCTCCTCCGAGTGACAGAACCCAAAGAAGCGAGTGCCTTCCTGTCGCGTACGTCGTGCTGG
ATGGAAGCTGCGCGCAGATCTCGAAGCAGCTGGCATATCCTGTCACTGGACGATACGTGCTGGTGAAGCTTCTGTGCCCGTCTTCGGGGTCCAACATTGA
CGTCGGTTACCTCGGGTTCTGCGGAGTATTCGATCGTGAAAATGGCCCGGCGTACAGCGAACAGAGTGTCGGCTCGTACAGCTGCGAAGAGTGCAAGAGA
GCACCTCTCTGTGGCGTCTACTACGGACCCAAAGACGACGACACAGTCAAGCTTTGCTCTGCGTGCTACGACGACAACAGAGGTTCGCTCGACTCTGCGT
ACTTTGCGTATGCTACACTGTCGGAAGCTCAAGATGTTGTCGCAACCGATGAGAACGCTACCCTGTGCGCCCCTCGCAAATCTTGGCACGAAAAGATCAC
AGCTCTTCTTGATATCTCGAAGAAAGTAAAGTCCTCCACTGTGGTGGCGCATTTTGATCTCGGCATTTCGACGTCAACAGGTCGATCCGAAGCTTCGGAG
AGACTATCTGTCGCCGCTTTTGACGACTGTGAGCTTTTCTCATGTGGGCAAAACAACTACGGAGAGCTTTGCCTTGGACACTGCAACTCTACGAGCAAGC
TGGAGCACGTGCCGTTTTTCTCCACAAAGAGTGTTCGGTGCATTGTCGGCGGAAACGAAGTCCTCGCAGTCGTGATGAAGGATGGGTCCGTGTACACGTG
CGGACTGAACAAGAGCGGACAGTGCGGCAACGGGACTTTTGAAGAGCGGGTCATCTTAGCTACTCCTGTCCGAGCGCTGAGCGGGATTTCGATCGATTCG
GTCGCGGCTGCGAATGGATGTGAACACATGCTGGCTGTTGCGACCGATGGTTCGGTGTACTCGTGGGGCTACAACGATCGAGGCCAACTTGGCCTTGGCT
CCACCATCTCGAAAAGTCACACTCCACGGCTCATTGACTCGCTGCGTGAGAAGTACCACATCACGTATGCGGCAGTCAGCTACCACCACAGTGCTGTCGT
CTCCAGTGCAGGCGAGCTACTCACGTTTGGGATGAATGACTGCGGTCAACTTGGTTTGGACCACACGCAACATCAGCACACTCCTCAGTTAGTCGACGCG
CTCTCGAGCCAGGTCATCACAAAGGTCGCTTGTGGCTTGTACCACACAGTCGCGGTGACAGCTGGAGGCGAAGTGTACTCGTTTGGAAAGAATGATTACG
GCCAGCTCGGTCTCGGCCACGCTCGCAATACCAAAGTCCCAAGCTTGGTGAAGATTTCTATGAGTGACAGTGACGAGAAGATAGTCGACGTGAGCTGTGG
GTACTACCATACAGTGGTCATTACTGAGAAGGGGAAACTCATCACGTGGGGAAGAAACGACTACGGTCAGCTCGGCATTGGCAGTAAAGACCACAAGAAC
ACACCGCAGTATGTGCCTCTACCGTTGTCGTCAAAAATCAAGTACACGTCCTGTGGATGCTACCACACGCTCATATTGCTGTCAAATGGACGAGTCATGG
TGTTTGGACGGAACAACAAGGGCCAACTTGGAGCAGGAGCAAGAACGCTGCCGTCTGCGGATCTACCACTTCCAGTTCCATCCAACTCGCTTTCGAATGA
CGATGTCGTGTGCATTGCAGCTGGGTTCTACAGCTCCTACATTTTGACTGGGCGGTCAAGCCAGAGTGACCCAGAAAGCGCGAAGGATGATCCAGCGCAT
GCGAAAGACTTGCTGGAACATAGCTGCTTAGCCACGTCTGAAGCTCTTTACGAGTCACTCATGAAAGAGATGGATCACCACAACACCAGCGAGATACCGG
CAAAAAGAGCTCCGATCAAGATCAAGAGAAGTAGCATGCAGCGAAAGCTGCCTCTCGTCAAGCTTCATGCGGCAGCGTGGGCCTTGATGCGTGCGCTGAT
GTATCAGTCTCTGCGCGGCCGTGGGTCCGAGGAAAAGAGCAAATCAGTCGGTCCGACCAAGCTAGCACTGAACCCTGTTCTCCGTATGTTTACTGGCTTC
TTACTTGAGAATCTGAAGCTGGTGCAGTCAGAAATCGGACGCAGTGGCAGTGACGCATCTCTGCAGGAAGGAGGAAGTCGTGCTGAGGCGAACATCAGCC
TCAAGACCATTTGCATCGGGATTCTGAAGTACTTGTCATTTAAGACCACTGCTGCGACTGCAAGCGAAGGATCTGTGGATGCACTGTATGCGCACTTCTA
TCGCAACCAAGTGTTGTGGGTGCTCTTGAAATGCGGATCTGTCGACAGCGATGTGAGCTCCATCATTGCGAGCAACCCCGAGGTGACAGGGCACGTGATC
AAGGAGATGAACTCTTCAGACTTGCCGTCTGCTACGATCTGCATCCAGCTAGCGATGCTCATTTTCCCATTGCACTCGATCTCTTCGCTCAACAAGATTC
ATCGCAACATCAAGCCGTCGCTAGCATTCTCAGGAGACATCATGAGCTCGTTGCTGCTCCTGGTCGGACATCCTCTAGTGCTTCGACCGCGGCTCTGCGC
GCATGAACTCGGTATTGAATGCTCCAGTTCTGCGCTCTGCCACAATGCAAAGTGCTTGAAGGGAGTATCCATGAGTGGAGATAGTAGCGTCAGTAATGTT
CAAATGCTGGCGCTGGAAAAGAACCATGTTGCAGCCGCAAAGGCATCGGAAGCGCTGAGTCTGATCCGCTACTTGACGTTGTATCCGACTTGGAGAGTAG
CAGTGAATGCAGCTCTGAATCGCGGGTTTACAAAGACTGAGAAGCTGGGAGAGCTACTGGACACTGTGTGCGCATATTACGCGAACATCCAGACTGCAGC
TAGTGGCGCACAGGTCTGTGCCAACACCCAGACTGCGGAGCCTATTGAGAGCTCGAATATCAAGCTGACGATCGAAATTTCGAGCGTTCGAAAGCCAGAA
TCTACAAGCTCGCCTGAAATCGACGACACAGATCAGTCTGACGCAGTTGGTACACAGGAAAACAAGGACTCGGAGGCCGCGATCGACACGCGAGACAAAA
AGTCGCTGTTGTATTGGCAAAAAGCGAAAGACGCGCTGGACGGACTAGCCACGATCTTTGCTGCAATCGGTATTGTAGGCGGATACACGGAGGTGTTCCG
AGAAGGTGGTTTTGTATCGATTGAGAACAGCGAGTTCAAGCGAAGCAGCAAGTCCGGATTGCTCACGGGAATCAAAATGGATCCTCGCTCTGAGATCATG
GCGTCTGTAATGATCAGCAAGGACGGCGAACATAGCGTTGAAGCGATGCTGGATACAACGCCATCGGTGGTTTCCGTTCCTGTGAAGAACTTGCAAATTC
GGGAACGAGTTCCAGCGATCGTCGGGATGTTTGACGACCTCGAGAATATCATCACAACTCTCTCGACGTTGGTGTTGCCGATGGCAGAAGACTTTGCAGC
TCATTCTGAGCTGGACCAGCCACAGAACAACTCAGTCCAAGAGGTTCTTCGAGCAAAGCTCAAGTTCTTCAAGAAGCAACTACAATGGCGATCAACAAAG
GCACTGTCGTCGTTGCTCAAGCAGATGCCGATGCTGACACCGTCGCTAGCAAACTCGGACTCCCAGCTCATTGGGAATCTCGCGGCACTACTTGCGTCAG
AAAATGCGCTCTTCAATTCGAGCATTCTGCAGTCGATTAAGATGGATGGGAAGCAATCGTCACAAAGTTGTGATGGAGTCAGCATTCTGCAAAACCGATG
GACGAGCCTGAAGCAGCGCCAGATCTGTCTAGATACTGAATCGGTGATTGACTCTACGCTGGATCACTACGAAGCTCAAATTCGAGAAGAAGTGGTTTTG
AAGCTGGGAAAAGAAAATGCGTTGAGTTGGGGCATTGACGCGATTCAATCGCCTCGTCGGAATGTGACATTCCCTGGCGCATTCAAGGTCAGCGGACCTC
CTATGGTAGGAGCGGCGACAGGAACTCGAACAAACTTAAATAGCCACAGCAGAAGTTCTAGGGATCTTCCGTTCGGCGTGTGGGGCGTGCTGCAACCACT
GCCACAGCTTAACGAAACTGAGAACGGACCGTCTGGCGCCAGTGGATCTCACTCGGGTGTTGACTTCACCCCGTTCCATTTGTCGACTCCAATCGTTCGA
GTTGGGCGTGCTGCCGACTCCTGTGACCTCATCGTGAACGATCGCAGCGTCAGCGGACGCCACTTCCACTTGCGCCGAGTGCGCCGCGAAAGTGAAAGCG
GTGAAGATTACTTCGAGCTCCAGGATTTCAGCAAGAATGGGACCATTGTCAACGGAGTACGTGTTCACGGCACGAGCATCCGCGTCACCCCTGGTTCACG
GATTTCGCTGATTCTCTCAAGAGGAGGTCTTGTGACATACGAGTTCCATGTACAAGCGGCGGGAACAGGAGGAAGCCGGATGGCGCCACCACCAATCATC
ACCAGCTCCCAGAATCCGGGCGACCTGAACGTCATGATTCCTGGTCAAGAGTACCAACAACCTCAAAACGGTACAGCAGGAGTGGTGGAGCCGAGAAGTC
CTGCTGAGATCCAGAACCGTGGGACGCGAGCAATTGATCCGTCGGACAACCGAGCTCAGATCTCTCGCAATCGCATTGCAGCAGCACAAGGACTGCGACT
CATCACGTCAATTGCTGAGAGCGAAGTTCCTCGAGCGCTGATTTCCCCGAACCCCGCAGTCGACTCTCCTCGGGTTGGCGGATTCAATTCCCCACGCTCC
TCGGTTTTGCAGGCACCTGGGACGCCTTCAGTCGGCTCTCCGACTGCGAGCATGTACCAGAACATGGTGCCTCCCGGGGTACTCTCACCAGCATCGTACC
AGCAAAGAGATAGCTTCTCACCTGGAGAACCAGCTGGCATGCGAATGCAAGAGAGCGCGGTCAGCGAAGCGCTTCGCATTGCGCTTGGGCGAGAGAGCGT
GAATCGGGAAAGTGCCCAGCGCCATGGTTCCCAAGGTTTCTTCATGGATGACATCCCAAAGACACGGCTCTTGAATGCATCTGGAGATGAGGCGTCGTCA
TCTTCATCAGCGTCTCCATTTGTAAGTATTGATTGGATTTTTAAAGAGGGTGAGAGTGGTACTAATTGTGTTCTCACCTTTTTCATTAGACCACGCGAGA
TGAGATGAATGGAAACTCAGCTGCAGAAGAGCTGCTCGCTCGACTTCAGGATGCAGGGTATTACGTGACGAAGGATCAGTGTGACCAGGCCCTGCGAACA
ACGGAGGGGGATCTGAGCGATGCGTTCACATGCGTCCAGATGAACTACCCACAAAAAATGGTAAGCGCACCACCCCTGCTTGAAATTCTCACTTCTCATT
TCATTGATAACCGTAAACTAACACCCGCTCAGGTGAATGTGTCGCACGAGTCTTTTCCACCGAATGTTCGCCATTTAGCGAGTATCCTAGGAAAGAGCGA
AGAGCTCTGCGCCGAAGCACTCCGCCAGAGCGAGAACAATTTTGGTGGCGCAGTAAGGCTGCTTTTATCAGCTCGTGGGGTTGCATTGGAGAAATCGCTG
CAAACCATTGAGCCGAAACATCAATTGGTATCGAGAAACAGAGGCTGTGGAGATGCAGCTCGCTTCGATTCTTCGTCTCAGAGCGAGATGATGATGAACT
ACCAGGAGCTGGTGGATGAAAATCCGAGCTATATGCTTACAGACTCAAGTGCCGCGCAAGCCCCACAACGCTTTACTCGACCAGGTGGAAGTCCGTATAA
GGCCAAACCAACTGACTCGAACAGAGAGTTTGTTCAAACCGAGATATCAGTGTGGAGCGAGTGCAACGGCTGCTTTGACGATCGAGTGTGCACCATGAAC
TGGCACGAGGTTGAGCAAGAAGAGGAGATCCTGAGTCAGCTACTGACTGCAGTCCACGCGCGAAAAGCTCTCGACCATGTTGTGCGGCTTTTCTCAAAGG
TTCGTGCCATTGTGTGCATGTTTTCTCTGATGTAGTGCTTATATGCTGATCAGCTTTTTATAATCCTTTGTATCTTCACAGTCTGCGAGCGACGGCGAGA
ACCTGCTCAGTCCTATCGGCGACCGGACTACGTTGCGACAGCTTGTGGCGTTCTTGGAGCGACCCAAAATCGTTGCGAGTAACAACATTGAGCCAAACTT
GGACAAGCCGCAGGGCAAACTCCAGCATATTCTCTCTCGGATGGCGAGTGATATCATGAACATGTCAACGTCACTGACACTGGCAAAGAACCTGCGCTCA
GTTGACATTCTATCGACGCTTGCGTTATCTGTCGATTTCAGCAACGACGACACGTCGAATTCAGAGTCTGCGGAAGTGGAACGCGTCATCCAAGCACTGA
TGCGGGATGATCCTACTGGCGTAGGGCAGAGTGATTTGAGCGATGTGGGCGAGTCCTTCCAACTGACCCTGTTCCAAGATATAATGTACGATGCGATGAT
GCACATCATCTCTCGCACACTTGTCTCGCCATCGTGCTCGCTGAATTGGGACGCGTCGGCATCGAAGAATCGGAAGATGGAGAGCTTGTTCCCGAAGGGA
CCGTTCAATCTCTCTGGTGGACTCGAGTGCATGGTTGTGAACTCGTACGAGAGAGTGTGGAGCGTCCCATCACCGAATCCTCTCCTCAAATACCGCCATA
AGTGGAGGCGCCGCCAGCAGTCTACTGGCAGACACACTGATTCGTGGCTGAGGGCTTCGAACGATCACCAAGTTACGATCTGGCGTCCTACAATGCCTAT
CGCACTCAAGGCTGGGGTCACGACGACCTGGTTCAGTCTCGGGGATGTCATTCATTGCGGTAATGACACTCCAGAGTTTCCTATTCTCCTTGTGAGCGAT
CGCGGCAATGGGTTACTGGTTCCTCCTGTCGGCTTTGAGCGCGTGGACGTCACTGGCAAGGGACTTCCGAAGAATATCGTGAGCGACGAGGATTTCCAGC
GGAAGCAGCTTCGATCCGTTTGGTGGCCAATCGCCCCGCCTGGATACGTTTCGCTGGGCTGCGTCGCTGGAAGTAAGGAAGATCCGTTTGAACCCCCAGC
TCTCTCAAGCGCCCGCTGTGTACGCGAAGATCTGGTGAAGCGCGTCGACTCGTTCCGATGCGTGTGGAGAGCGGAGGCGAATACCAGTGGGGGCGCAGTT
GGCAAGGCTGGCGAAGAGCACGGTTTTTTCAGTACGAAGAATCAGTCAGACAATGGCGTGAGCGATCCTGACGGCGTTGTCGTCCAGACGTCTCTGTGGT
CGATCAATTCTGAGTTCTGCGGCGGCCTGCTGCCTGTCGTCACGCTTAACGAGATCGAGAACACGGAGCCCAGCATCGCGTTTGCACTCAACCTGTCCGA
GGAAGACAAAATCCTCTGTGCGCCAGTGACAGTGAGCAACGTGCTGGCGTTTATGGACACGCTTTTGCTGTGCCAAAAGTCTCTACACACTCAGGGTGGC
GGTAGACAAGATGCCGCAGTGCTTCGCCCGGAACTCTCAGCAGGTCTTTTTGCACTTGTGAAACAAGTTCTGAAGGAGAAGATCCCAACGTGCGGCCAAC
TAGCTGTGGACTTGGTGCGAGTGCTAATCAAAGTGATTCGCAGCGGAGGGCAATGGAAGGATAAGCGTGGTTTGCTCTACTGCCGTTCGAAGATCATGAT
GCTGAACCAAGATCAAGAAGGTGGGCTCATGCTCAACTCTCTTCTCCAGGCTTTGGTTGAGCTCATGCTGGTGGTCGAAGAGCAGAATAGAAGTGACCGC
ATCGAGGAGCTCGCATCCTGCTTGGGACCAGACTCGTGCATCAGTTTGCCGTACCGCTACCATTTCGCACGAGAGCCGAGCCACGTGGAAATGATGGTCA
GTCACTCCTCAAAGATGACGGTGACACGCCATTTCTCGGGCGAAGAGCGCAAGTTTCTGTTGGAGTACCATGCCGAGGAAGCCAACCCAACGGCTTCCCA
GTCGGACCTTCCACTCAACGAGTACTACTCGTGCCGGTTCGAGCGCACGCCAGAGCTGGTTATGACCATGAAAGACATCGTCAAAGCTGAGATCGTGTAC
TTTGAAGTCACGGTGGTCGAGTGGAGCAACGCGAGCGCTGGCGCGATTGGCTTCGGGTTCTCGACGCCAGAGTTTTCGCTCGAGGGAGCTCCTGTTGGGC
TCAACACGAATCGCGCGCACTCGTTCTCATTCACTCCAGTGAGCGGAAAAGTACAGAGCACGGATCCTGCAGCCGACCATTGGAAGTGGAACGAGCAGAT
CGCTGCAGTCGCAACTGGAGACATCTTTGGTTGTGGACTTCGACTTGATACGGACGAGATCTTCTTCACCAAGAACGGACAGCTGCTGGGCATCGCGTTC
TCGTCGATTGATCAACCCCAGGACTTACACCCGACAATCTCTCTGAACAGCGATTGCAAATTCCTGATCAACTTTGGACAAGCGGTGGGACACGAGGTTC
AGTCGACCAAGGCGAACTTTAGTTTCCGGTTCAACTCGATGGACTGCGACAACCTCATGGGAGCTTTCGAGTGGTATGAGCACTTGAGCCAGGTCTACGG
GGTCATGAACTCGCTGATGGATCCAGCGCGGGACAGCCCTGGTGAGAATGTGGTCGTTCAACATCTCCCGAACGAGTTTATGCTGTCTGCAGACAACTTC
CTGTCGGAGATTTCTGAGGATGTCTGCATCCGAGTTGAGAGCACGCACCCTTACGACCTCGAGCTGCAGGAAGCGCTGGTTAGCATCCCGCTGGCGACCT
CGATTCGAGTGAAGCTTGATCAGCAGTGTGAGACCGCAAACTCGCACTGCCTACAGATTCTTCAAGGCGGAGAGAATGCTGAGAGCAGCGAGTCGGAAGT
GCGAGCGTTCACAGGCGGCTGCGGCGGACAGGAAGTGATGATCGAAGGCGATAGCTTTGTGTGGCGCTTCCCTGTCCAATCGAATTTCCAGTGCCGCGTG
GATCGTGTGCGGAAAGGGCCGTACTTGAAGCTGGAGAACAGAGACACGCGACTCTCGCTGACGAGAGACAAGGGCTGGCAGACAGCGATCGGAGTGGCAA
GATTTGATAGCGGCGTTCATATCTGGGAAGTCCGCATTTCGTTCGTTACTGCAAGCTCCAACATCTTCCTGGGCATTGCTCGGAAGGACGTTCGTCTAGA
CTCATACCTGGGTAAGGACAACCGCGGCTGGGGCTGGATTGGCAATCGCGCGCTCTGGCATAACGGGAGCAAGCAGCGTGGAACCTATGGCGAGAAGTTC
AAGACTGGAGATATTGTCAAGATGACCCTGGACTTGAAGCGTGGGACATTGTCCTATGCTCTCAATGGGAAGGATCTCGGAGTGGCGTTTGGATCAGGGG
GTACGGGTCCAAAGCTTGAAGGAACATTCTACCCAGGATTCGCTTTGTACAACCAGCGCGACTCGATCGATTTGATCGGAGGCCATCGCGTTGAAGATGG
CGGCAGCGACGCGCTTCATCTGGCAGGTAGCGAGCTTGCTGGTGTGGGCGGAGATGAGGTCTACTACAGCGAAGACGAAGGCGAGGTCATTGGCGACGCA
GACGAAGGTATTCCGAACTTTCGAATGGAACTGGCGACTGCGCTGAGTCAAATGGGGTTCCCCATGGAGTGGTGTGTGTACGCACTCAAGCACTGCGACG
ACGACGCGGAGCAAGCTGCAGACTTCATTCTTGCCAACATGCACGCGATGGATGCGTTCGTCCGTGAAGAGGCTGAAGCGTACAGTCGCCACGCTCGCCA
CCGAGAGATCCTGAGCGAGCAGTCGATTGCGTTGGAGTCTGTTGGTGTTGCGGGCCACCAGATATCTGCGATTGTGGGTGAAGATGAGAGCACACAGAAT
GGTACTGACGGTGCTGACGGCAGTGGCGGTGATTCGCTGAATGCGTCGCAGAATGTGGACAAGTGGGGGATCGCGTTCACAGCTGTGCCCGAGTTCTCAG
TGACTGGAAGGCGGTTGCTGGCGACCAAATACAGCAAGAAGCTCAAGGAGCTCCACAATTCGCAACTCGTGTTTACGTCAGAGCACGACCGGGCGCTGGT
ACAGATCGTAAACGAGATCTGCGAAGCCCGCGCCGAAGCGCTTCTCAGTTGCGACCCGCTACGCATGTCGCCAGAGGAGTTTGTGCCAAGTGAGGAGCAT
CTGCGCAAGTGTCCGTGTCTGCGTGGACTGACACTCGCTCAGCTGCAGAAGCGATTCCTGATCCTGCGCAATTTCAACTGTCGTTTGCAGAACTCGCTCT
CGTTCATCGACTTCTCGATCGACGATGCCCATTCGCTACTGGCGAAGGGTGCGCGCGTGCTGCGCGGCGTCATCTTCCAGCACGTGAAGCTCGCGTGGTG
GCTCAGCATTCTCAAGGAGCAACAGAGCCCCGCGGCGGCGCGTCCCGAGATTGAAGTAGACCGCCACCGCGCGCGAGAGGCCACAGATGTCACTGGCGAC
AGAGAGAGCGTGTTCGCTCAAGCATTCGACCAGCTGTACACGATTCAGCCTTCTTTGCTCAGAGGCGCTGATCGTGCGTTCAAGTGCCAGTTCGTGGGCG
AGTTTGGCGATGACTTTGGCGGACTATACCGCGAGTGTCTCGCGCAGATCAGCTCGGAGCTGCAGTCCAAGACGCTGCCACTGCTCAAGCCATGTCCGAA
CGCGATTAGCGGCGTGGGCGAGAACCGCGAGGTGTTTGTGCCGAACGTGCACTTGCGCAGCGACCCGCGGCTGGTGCAAATGGCCGAGTTCCTCGGCAAG
CTCGTGGGCATCGCGATCCGCACCAAGACGCCACTGGATCTGAACCTGCCATCCGTGCTCTGGAAGGCGCTGGTGCACGAACCCGTGGCGCGCCGAGATA
TCGAGTGCATCCACCAAGGGTGCTTCCAGGTCGTGGACACGATCTACAATATCGACGCACACGGCATCTCGGAGGGTATGTTTGATGAAATCATCGACGC
GTCGTTCACTGTGCTGTCCAGCGCTAGGCAGGAGGTGGAGCTCGTTCCTGGCGGCAAGCACGTGCGCGTGACGTGGGACGACAAGGAGGCGTACGCGAGA
GCGGTCGAGAAGTACCGACTCGACGAGTTTCGGGAAGTGTGCGACGACATTGCGCGCGGTGTGGCGACGATCTTGCCGACGCCCACTCTGAGTCTGTTCA
CGTGGCGCGAGTTCCTGACGCTCGTGTGCGGCAAGGCGACCGTGGACGTGGATTTACTGCGGCGCCGGACGATCTACGGGGACGGCTGCCAGGCCACAGA
CCCGCATGTAGCGTTCTTCTGGGACGTACTAAGCGAGTTCTCGGACGAGCAGAAGTCGTCATTCCTGCGTTTCGTGTGGGGGCGCTCGCGCCTGCCGACC
CATGCGGCCGACTTCACGCAGGACTTCAAGATCTCGGGGCTGCCCAAGTCGGCCGGTCGCGCTGACATGTACTTGCCGATCGCGCACACGTGCTTCTTCT
CGATCGACCTGCCCGTGTACTCGAGCCGTGACGTGATGAGGGAGAAGCTGCTCTACGCGATCACGCACTGCCAGTCAATCGACGCGGATAACACGACGGT
CGCGCAGCGGGCGGGCCAGGGGCTCAACTGGACGGCGAACGCTACTGTGAATGCGAATGCTGCCAGTGCAGTGCAAGCTACGGCGTCAGCGGCGGTGTCG
AGCGTCATCGCGGGCATCACCTCGGCGGCCATCATCAGCACCTCCGAGACCTAAGATTTGTTTTTGTGTATCGCTTTTCTCTACAGATATGAAGATTTTT
TATATATGAATGCAAGCGCATCTACTCTATTTATTTTCTCTATAGCGCAAGCTCAGGATGTCTTCGCATCTTTTCTCTTTGGCTCGGTGAAGCGCTTAGG
GATCGCCTTCGCGAACGCGCGCGGCCAGTCGCGGTGGTTCGCAAACTCGTTCAGCGCAATGAGCACCGAATCGATGTTGAGCACGTGCGTGCGCACCGAG
AGGTGCTCCTGCAGCGGCAGTCGCACCGTGCGATACGCCAGCGTCTCTGCTTTCCCAAGACTCTCGCCCTGTTGATAGATAGATAGATGATGATGAAAAC
CATACGAGTCGCTCCGATCAGTGAGTAGGTAGCCAAGTATCACCAATAAATCAGTGCGTCTGAGCTCTATCTACACTCACCTTGCGCACCGACCGGTCCA
CAATACCGCCGACGACATACACGCACGCTGGGTCAAGGTCTTGCAGCACGTTCTCCGAATCCGGAGACAGATACACAACCTCTGTTTGAGAGAAGAGCTC
CTGCACGGGCTCTTGGTGGCAGGTGATCTGCATTGATATGCACAAAGGAAGGGTGTCATTGCATGCCACCAACTTGTCAGGTTATGGACCATCACTTGAT
GGCCAACCCACGAATAGACTCACCTTCCAGTGGTTCACGCCGTGCTGCTCACAGAGCGTCGCGACGTCGCCCACGCAGGACGCCACGTGCAGCGAGAAGA
GCTTGTCGAGTGGACATTTCTTCATATAGCCGTAGACACACCCGAGTTGCTTCAGGATGCTGTTGCACTCCTACAGCATCATTGCAGAATCGTAAGTTCG
TATCTTGTCTGACCATCGATACAAGGAGAATGCAATCGCTACGTACCCGCTGAGACTGCGCTACAGCAAAGCCCAAGTCCACCACGACACGCAGCCCATT
CGCCTTGCCGTCGTCCAGCTTTTGCTATTGCCACACGTTCACAAGTCGCACAACCAATCACTACCACATGTTCAACACCAATAGCAATAGCAATGCAGCA
GCTACATCATGGACCGTTACGGCAGGCGTGTGTTACACGTGCAGATTGGATAATGCAACGTACGTATTGCTCGACACGCTGCATTTTGGTGCGCTCCATC
TGCTCGTGCTTCTGCTCGTCCGTCATGTCGAGCTGTTGTTCGCTGCGGATTTTGGCGCGCTCGTGCTTCTTGGTCGCGAGCTGCTCGTCTTTCTTGGCGC
GACGACTCAAGCGC