Description :
From Genome Similarity Track
Location :
Scaffold_343:27671- 29542
Sequence
1871 bases(100 bases per row)
CTACACAACATAGCTACTTTATTTGAACAACCACCAGTAACACGACGATACAAACTAGGACCTCGAACCACCTTAACCATCAGCATTCAAAATTTACGTG
GATTTGCGAAGAAATCACGTTGACAATAGATGAGCGGGTGGCGTAGAATTCGAGGCAACCGAAGACCTGATATTATTTTACTCCAAGACACACAACTAAA
AAACAACCAAGCAACAAACCAAATGATAGACCAATGGCAAAGAGCATGGCAGTGTGGTGAAGCAGGTCGTTGGAGAATGGCACGACGTGGACTGAGGGGG
TAGACGATGACGAATTGGAAGACGGATGGGATCAGACGCGGTGCGACGGGAGTCGAACTTTCCGCGAGAAAGGCGGAGCCGGATCGGACAACGGTGCGAC
CCGCCTATGTTCTTGGCTGAGGTGGATCTGCGACATGTACGGGACCCGGCGGGTTCCCTGATCAAGAGCCACGTCTATGTCCCCGATCTACAACCCAATG
GACGGGCTCCGATCCACGACTCCGATCCACGACCCCGATCTAAGCCGACCGATGGACCCCGATCTAGCAACCCGACAGGCCCCGATTCAACAACTCAATC
TCACGATCAGGATGTATCAGGGTGACTATGATGGGCAAGTACGACAGAGGTGATGGGGAAGGAATCAGGAGGCCAACCAATGGCGAAGGAGGTATATATA
GTGTAGGACAACATAAGGCTCAGTCCCTAATTCACTTTGTGATACGCAAGTGGATTTCCTTCGTTCCAAGAGCCAGCAGCCTCGACCGAGAAGAGCCCCA
GGATAAATCGGCCCCGTCGTCCGCTCCTGGATCGGTGTACTCAACCCCCCAACATCCCGTGCCCAATAGGAGGGACACGTTAAACAATACCGTCCACGCG
TCGCCGATATCCCGACGCCGAAGACGAAGAACGCACCGGCCCGATAACCCCGTGCACAACCGAGGAAACGCCGGCCCGATAACGCCGCACGCCCAAGGCC
AAGGAAGGAGGACGTCGTCACGCACGAGTGAGACGTCAGAGCAAGAGCGACGCAGAGCGAGGAGAATCCGCGCTGCGCCCAAGAAGCACGCTTCATAGGT
CCTCAAACCTACTTGGACTACACCCTACCCTGAGATATGCTGCTCAAGTGCCGGGGAATTTGCCCGACGCTAACGCGAAGGGTTTGTGCGAGGACGACTT
CGCTAAGGCGCTACTCCACAGCAGCTGTCTAAACCAGACCATGACTTGAGCTACTGGGCAAAACCAACGACGAAATCAGCAGGACTGGGTATCCTAGTAA
CAACCGAAATCAGCGCTCGAATCAAACCATGGCAGCAAGCAAGCTGGACATCACGAGTGATGGCAGTAGAACTTGATGAATGGCTCATAATCAATATGTA
CGCACCTGCGCAGCACAAAGACCAAGACCGATTTTTCGCAGACCTTGAACCGTGGATCTCACAACACTCCTCCATTATAATTGGAGGGGACTACAACTGT
GTACTACAACCTCACCAAGACCGAGTAACAGCCAGAAAACCAAGTAATTCCAGCAATGAAAGCAAACTTCTCAGCACACTGCTTGATAAGTGGGACTTCA
CTGATGCTATCAGCCTCTCACGTAATTTGGATGACGATGAAGAGGACCACGACCCTCTCCATTACTATACACATTGGACCCAGAACGGAGCCAGTCGACT
AGACAGATATTATGTAAAAGGAGAACCCTTTACTGCAACACAATGGGTTAGCGTGCTGGAAGCAGCGCATAACTCCGACCACCGGGAGGTAGACTGGAAC
TCACAACAGGAACAACGACGACTACGACAACAAAATGAATACTGTACTACCCTATCCAAACAGGCAGACCC