Description :
From Genome Similarity Track
Location :
Scaffold_153:27668- 29417
Sequence
1749 bases(100 bases per row)
TCGTGCCTGCAGACTTCTAAGACCTAGTACAAGTTCTGGACCCATGAACGATGCAGCTTCACGTGAATGACTTCGATGATACATACAGTCTGCTTCATGG
TGCCTGCAGTACATGTAGTGCGACCACACTTTGGTCGCGTCGTCATACAGTCGGAGGTTTAACATTTTGACAATGGTGAGCGAGGGAACAGGTTACAGTC
GGTACAGCATGGACAAGTATCGCCGGCTGCAGGTCTGCCTGACCAAGGTCCAATCTCCCTCGACGGTGTGTCCTACGAAGCACAGTGCTACGCGGTCCGA
GCGCATGACATCCTGCGTCCAAATGTGACGAACGCAGCCTTTCCAATTCCGTGCAGCAGCTTTGCCCAAAGAAAGTGGCGTTTCCCGACTTGTTTATACG
GTTGTATAATTCAAAATTGCCGGCtaaaattaatatataattttaCCGGGCTTTCATAAGCAGGAGCGCAGGGAGCCGCGCGCGAAGCGCGGTGGGGCTC
AATCCAAGCGAGCGGAGCGAGCTGAACCCCGCGCTCGGCAGAGTTTTGTGCCTCACTGTAGGCTGGGTGACACATGTACTCAAGTTCCCGACTCGACTAT
TTTATCTGGACATGTATAGCAGCGTTTAACACAGCGTAACAAAAGATGCGGATCGGTTGCAGGAGTACGCACTACTGCGACGTCCTGCTGTTGGAAGCAA
CACGTGCCTTTCCCAAAACGAGTACCAAATTGCAACTCTGTCCCAAAAGGAGGCAGCCACCATTGCGCTCGCATATTGCTGGTGCGAGCAGCTGCACCCT
GGGCAACGAACCGTGGTGCACTCGATGAACTGGCGTGCCGACTCGCACGTGGGCACGATGGACTCGGCCGCGAGGTGGTTGTTGTCGGTGATGTGCGGCA
CCGTAGTCGCTCGCCCGCTTGGACAATATCCGCAGCAGTGGCTGCTGATCCATACTTGTACGTGTACACATTTTTGGACGAGTACTCCTTTTGGGACGGA
GCTGCAAATCGGTACTCTTTTTGGAAAAGCTCTCTGCGGCAGACTGGATTCACGCGAATGTCTGGTGGCTGCATCTGGCGCGCAGAGAGGACGATCTCGG
TTGGTACGCGTGCAGAAATCTACCAGGGTAATCGCTCGAAGTGTCCAAGCTGACATTACAGCGCAGCAATCGACCCGAGTTCCTCCCGTTTCTGTACTTT
ACGACTTTCCCCACCGCAACTTTGCGGCCGGCTGCCTCGACATGCGCCTCCCAGCCTCGGAGCTTTGACCCAGAAGCCGAAGGGTGTAGAATGCTAGTGC
CGCGCTGTGAACGCCGCGTTGCATGCTGTCGGCAGGCTGCCTGCCAGGCTATCGTCTGGCTGCTATGTGACCCTTGCCCGTGTGGCACGTGGCAGCGAGA
GACCCACATGATCCCATCTTGAAGTCGGCCGACGTCGGTCAAGTATGCACTGGTCAGCTCCACACGACATGTACTAGTGGTGCTAGCGGTTGCCAGTAAC
ACTGGCAGCAAGCAGGCGTTGGTGCGTGGTTCGCAAAGGCGGAGAACGTCGGGAACTAGGCGGCATGGGCATTCACGACGGCGCCGTAGAAAGATTATCG
GCGACGGCGCCACCGTCCGTCCAAGTCTTGTCCCACGACGGCAAAACAAAACCGCAAACAAAACCGCGAGCCATACAAACCCGCTATCACCACTGGACCG
CACTCGCACTCGCGACGAAAAGCCCGTCTCCCGTCGGATCGGAGCCAGC