Description :
From Genome Similarity Track
Location :
Scaffold_41:27658- 29845
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_41-snap-gene-0.27Alpha mannosyltransferase

Sequence
2187 bases(100 bases per row)
CTCTTGATCGGTGTCAAGACGAGCGTGATCAGCGGCTTTGCCCAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCCGAAGCACTTGGGCAAGTGCAT
CGGCGTTTCCAAAGCATGCCAAGCTCTTCTTTGTCGGATGTCAGCCAGTGCTGTCGAATAGCGATCTTCGTTCAGAAGAAACAGCAGACAACAGCAACGC
TGAGCTTCTGCGCGCGATTGAGAAGGAGAAACATACCTACGGTGACCTGCTGACACACGAACTTGCATGCCAAGACTCATACTTTGCGCTGGTCGACAAG
GTGAAGGCGTTTATGCACTTTGCCGTGACCCAGTTCCCGACTGCGCAGTACGTGATGATCGCAGACGACGATATCTACCTGCGAACGGACCAACTTGTGC
ACGTGCTTCAAGTGCACGGACCTCGATCTCGCGTGTACGTGGGCCAGGTCTGGGCCAAACAGTTCATGGCGCCAATGTACCCCATGCGCAGCCCCACTCA
CAAGAACTACCTCCCGGAAGAGCAGTACCCGATGAGTGAGCTCCCGCCGTTTGCGTTTGGACCGCATTATTTCATATCGATGGATTGCGCCGCGTTCATC
GCTGACAACCGCGATGAGCTGCGTGGTCTCGCAGCCTTGGACGATGTCTCCGTCGCGCTCTGGCTGCTGGCGCTTCAAGTCCACCCCGAGCACGTCGAGC
ACTTTCAGAACCTGCGCGACACGTCGTGCACGGAAGGCCTGATCTCGCTTGCAGATCTGAGTCCGAGCGCGATTCGCATCATCCATGCCAACCTCCACGC
AGATGCTCCCTTCTGTCGTGGCGCTGATCTCACGACGTGGCGGAAAGCTGAGCGCCCATTTCGTGCCGCCGAGACCAAACGCAAGTTCACAGTTACTACG
AAGATCGCCATGCATACCAATGGTTTGCAAGTGATGACAACTTTCACGATTGACAGCGCAGGCAGCATCGAGTTTGCGTATTCGCCATCCCGAGAGAGTG
TGGAGCAGCATGCTGCAGCCATCTGTGAGCACTTGCAACCGTCACTGGTGTACAAGTTTGACTGCAGCAGTGACGTCACTCCGAAGGTGCACAGCAGCAT
GGCCGCGTCTTTGGAACACACGATGGAGAACCGCGAAATCAACCCCGCGTTCCTCGACTTATGGACTCATAACCTTCAGCTCTTCAGACCAGACGCAACG
GTACCAGCTCCAGCAGCGAAGATCGTCGTGTATTCGCGCAATGCCATGTTCTCCAAGACACTACTCGAGTGCCTCTTTGCCTCGGTCTACACGCTCAACT
CTGTGTTTGTCGTGGACGAGACAACATTCCACCAGCACCCAGAGTATCAAGGTGTATCTCCCGATGTTGTCGTGTTCTCGATCTTGGACGGCAACTGCTG
GTCCGGATGGGATCCTCGCTGTCGACAAGCCGTAGCAGACTATGTTCAGCTCTACGGCAGTACGTCTTCGCTCGTCATGATCTCCGGAGAGGCCTGGGAC
GTCGACGGCCTCGACGAAAGCGTGCTGCTCATCTCGACGGTCGCTCACGTACCTCGGCGCAAACACGTCTACATCCCGATGGCGAGTCTGTCGTTTGGCG
AGCGCCTCATTCAGAGTCCGTTGCTTCTGCTTGCCAACACCGACAACGGCCCCAGCAGCCTTCTCGAAGAACCGCAAAGTCAACTGACGCACCGCAAGTT
CTGCGCCTACATGTACGCGCGCTGCGATCGGCCGCAACGAGAGTACATGTTCGACCTGCTGAGCGCGATGGAGCCTGTGGATGCTCTGGGTGCGTGTCAA
GGCTCTTCAAGAGCACCGAACGAGAAACGGTGGACAGGACGAAGTTCCATTTGGTACAATGACGACGCGGTGCGACTCTACTCGCAGTACAAGTTTGTGA
TCGCGTTCGAGAACGGACAGCACCCCGGGTACGTGACCGAGAAGCTCGTGAACGCGTTTCTCGCCGGCAGCGTCCCGATCTACTTTGGCCACTCCGAATC
TGTCGCGCAGGTGTTCAACTCCGAGAGCTTCATCGACTGCGGCCGCTTCGCGATGCTGCGCGAGTGCGCGGCGTTTGTGATCGAGGTGCACCGCTCGCCA
GCAAAGTACGCGCACATGGCGCGTGCGCCTGTGATTGCAAATGTCTCGTTGTTCCACGAACTCTTTTCGTGGCACCCAGACATCCCG