Description :
From Genome Similarity Track
Location :
Scaffold_283:27651- 30496
Transcript NameFunction/comments
Phypl_g6428hypothetical protein

Sequence
2845 bases(100 bases per row)
AATCCCATCAGTGAACTGCCGAAACGTAGTACAGTACACTTCCAGGATCAAAGCGTTGGCGAGTCAGTGTGAGCGTCCGCCACGCTCTTGCCAGAATCTT
CGGTAAAATAATCCCCCATGCCAAAGAAAACTTAACTTGAATGCCACTCAAGGTTTGCACTCAGCCTATACCCTTGATCGACTGCATCGTTTTCGCAAAA
CTCATAAAGTAAGGTATCGTGTGGCAGCAGAGTGAACAACCCAAGCCGCGTATTCATGTGATGTTGACAAACGTTCGAGTGAAATGTGCAAGCGGCGTTC
GGAGACGGTCTTGACAACGCACGCAGTGCTCGTTCCCACAACATGTTGATACTAGTGTTTGAATCCCCATTTCCTGCCGCTTTCGTAGTCGAGTTCCAAG
GTCGACGAGTTAACGAAGTCCGACGAGATTTGACGAGCACATCTCGGAATGGAACGAACTCCGACGCACCAGCTTTGGCAGATTTTTAGTGGCTATGGCG
TTTATTCGATCGGCCAGTACTCGAGCATTGTCGATGCCGAAAAACGTGAAAGCCGCGGCGACTGCACTTGGAATGCGTCGTTGACGTGTGTTTTCATCGT
CTTGGATCACGTGGTCGAAGAACAGTCGAGAGAACTTCAGACGAAGCATTGTCCTAATAGCGCGACCAAAGTGAGTAGATGCACTGGATTCGTAGACGCT
GGGGGTGGATTTGCAAGGATGGAGTGACCGTTTATCAGCTGAACTCCAAACCCTTTTCGAACGATTTCATTCCGAAGTATTCATCAACGTGTGGTATTAC
TTTCGAAGTGTTGTTTCCCTGGTGAGGCAGGTCTTCATGGCGAAACCCCAGAGCCAGAGAGAGGTTCTTTCCATTCTAGACGTAACTAATGCGATATTCA
CTTGTGGTCTTACACCGCAAAATCTGCAACGACCCCGGAATTGGGGCTCACTGGCTTGGCCTGGCACACGCACATACCAACTTTTTCTCGACAAGCGCGT
GTTTATGTTTATTACTTATTCATTCATGGCACGCCAAAGCATGCACCCTACATGAAGTAAACACGAAACGCCTAGCACAAATACGATTGATGCGCCCAGC
GTGGCTTTCGCATCGTCGGTAGTTTGCGTTCGAACTCGTAGTCAGCCAAGCGCTCATCGATCGGCGTCACGAATTCGTAGCTGCTGAACACTGGACCAGC
ATACATGACATTGTCCACGACAAAAAATGCCATCAGCGGGTGCCCGACACCAAGGTGCAGCACGCCTCCTGGGTCGCCGTGTACGGTTGATGGCGAGTCG
GTATGGACGACCGCCACGATCACGTCGCTCTTACCAGAGTCTTCCCGGCTTTCGAAAAATAATCCAGGATACCATCCGCAGTATTTCGATCCGCCACTTC
CGAATCGCTCCTCCATGACTGTCTTCAAGAAGTTCACTTGATCTCCGCTTAAAGGTTTGTGCTCAGCCTGGAACATTGCGATCTCTTCAATCGAATGCAT
CTTTTCCGCAAAAGAGCGGAAAAATCGCTGAGCGTTGCCCACCAGGTATTTGCTGTCGGACTGTTGTAAACCAAAACCAAGTTTGGTTGGTGGCATCTTT
GACTGCCCACGTGAAAACACTACCAACGGATCCAGCGCTTTCTCAATCATGGTATCTATTTGCTTCGCTAGTTCTCCCATTCGGCTCCAGAAGAGGGGGT
ACGGGTCCACCATGCCGTCTGCATATTCGCAGCCACACACCATCGTGTAGCTTTGCTTGGAGTAAAGTAAGGTATCGTGTCGTAGCTGAGTGAACGACCC
AAGCTGCGTGTTCatcaggcgctgctgccaaaCACGCGAGTGGAATGTAcctgcagcgcttggagaCGGTCGTGACAGTGCACGCAGAGCTCGCTGCCAC
AACATGCTGATGCTTGCTTTACTGTTGAAGGATTCCGAGTCGAACTCCTGATCCATGAGTTGACGCAGTGCCACATGGTTGGTTGGACGAGAACGGGATG
CCATCTCGGAACGGAACGAACTCAGAGGAACGaaacgcagcagcatttGGCGGCTTGACATTCATTCGGTCGGCTAGAACTTGGGCAGCACTGTCGTTAC
CAAACAGTGTGAAGGCGACGTCAACAGCGCTAGGAATGCGTCGCTTCTGCTTCTCATCACGGTGGATCACGCGGTCGAAAACGAGTCGGGAGAAGATGAA
TGAACTCCAGACGAAGCGCTGTCCAAGTAGAGCGAACGACGCCGGCGGAGACATTGGTGCCGTGGAAGTTGGTGGTTTGTTTTCAACGCGAGGGTGGCCG
TTAACCAGCTGAGCCCCGAGTCCTttttgaagaagctggtTCTGGATGCCCTCCAAGGTTTCCAGCGCTTGGTCACCGTTGCCTAGAGCTGAACCATCCG
TTGGCAGCAATTGAGCAAGCTGTATAGGTGACAGCGCATCGGGTCCCATTCCTCCATCGGCCACCAGACTGGAAATGAACGCGTCAACACTCGCCACAAT
CTCCAAGTTTTGCGACTCGCGTAGGAAATGCACCAGCAAAACCGCGCAGCGCAGTTGATGAAGCTCCTCCTCTGCATTTtcacctccagcaacgcGGAAA
TCAATCGTCCCGAGCCAAATCATAGCGCGGAAGTAGCGCGTTAGCCCCTCGGACTTGATGTAGTGCCCGCGAGGCTTGAACTGCGAGAAATCGACGTCAC
GCTTTGCATAAAATATCTCTGTCGTACTTGTGGCTTCGGAGTGAACGAGCGTCAGCAAATGTtccagcttgagcgtggTCTCACAGGGACCGTCCACTTG
TTCCCCTCGCAAGAGACTTCGTGTCACTCGGAGAAACAACTCTAC