Description :
From Genome Similarity Track
Location :
Scaffold_12:2764- 5940
Sequence
3176 bases(100 bases per row)
CGGAGTTGACTTCGCTTCCAGTAATGAACTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCGTTCTCTCGGACGCCGAGAG
AACGAAGAGCGAGAATGAAGAACTGAGGCAGCTCTTCATGGAGAGCACCACTGAGCGTGAGGACACTCTCAGTGCGAAGACTAAGAAGGAACGCTTTGAG
GAGCAGAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACGAGATTCTACGGGAGCACGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGG
ACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCATTGACCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGA
CTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAGTCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGCCAAGAAGCCACAGCGCGGTTGGCGC
ATCGTTCATGCATACAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTA
TCTACAGTGCTCATGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATACTCTG
GGAGTGGCTGGTGATGCCGCAGGGGCCGAAGAACGCCCCTCCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGC
TACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCAGACGGGATGAGTGATGTTGAGATGCGCAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGTGCA
AGCAAAAGCTCTATGCAAACCTGAAGAAGTGCATCTTCGGGGTGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCC
TGAGGAGGTCAGAGTGATCAATTAGTGGCTGACGCCGTCGAACGTCAAGGAGCTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAG
GACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGATTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGC
GGGGCTTGACTGAGGCGCCGATCTTGGCGGATGCCGACCAAGATCGCCCATTCCACGTTGTGTGTCACGCATCCGACTTCGCAATCGGATGTGCGTTGAT
GCAGCACGATCACGAGGGCCTTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTT
GCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGAGGTCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGT
CGCCGCATATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGTAGAGTATAACTTCCGGGTTGAGTATAAACCCGGAAGACTCAATGTGGTGGCCGA
CGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAATGTCGTCACTGTTGGAGGAC
GTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTATGGCTCAGCACCTTCTGACAATGCTCGTCAGAAGCTGCCGAAGCATCTTC
GTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCACCTGCGACTCAGG
ATCATGTATGAATATCACGATGCACCGACTGCGGGGCATTCGGGCCGTGAGAAAACATACTTTCTTCTCACGCGGGACTTCTACTGGGCCCACCAGTATA
AATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTCTGCGCGGGCTCCCTTGCAGTCACTGCCGACTCCGTCGGA
GTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGCTGACCGCTTCAGCAAGATG
TACCATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCTCGTCTGTTCGTTGACATGGTGCTCAAACACCATGGCATGCCAATCGACATTG
TGTCGGATCGAGACCCGCGCTTTACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCAACTGCGGACCATCCGCAGAC
GGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTACGAGGTACGCTCACTCGTTCCAACACTGGAGCGACTGCCTGCCGATGGCGGAG
TTCGCCATCAACAACTCCGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCAGGATGGTGG
CTCTTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCACTGACACTTGCACAGTGTCAGCCGCGACCACGCGCAAGAAGAA
GAAGCACGCGTCTGTGCAGGGCACAGACGCCGACATGAGCAAGAAGAAGAAGAAGAACGGGTCTGTGCAGAACACAGACACCGTGAAGACGAACGCAGAG
GCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCTGTCATTCGGTTTGTCCAAGACGCTA
TCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTCAAGAAAGGTTCATTGGTTTTGTTAGCAACTCA
AAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACAGTGTTGGCACAACATGGCAACGCCTAC
ATGCTAGATATTCCATCTAGCATGCGCCTCCGTCCAACCTTTTACGTCAGGCGGCTGAAGCCATACTGGCAGCACG