Description :
From Genome Similarity Track
Location :
contig_265:2764- 3808
Transcript NameFunction/comments
g14432.t1XP_009516631.1 hypothetical protein PHYSODRAFT_344027 [Phytophthora sojae

Sequence
1044 bases(100 bases per row)
GTCACTCCTCGCTAAACTCGGTCCACTCCATATCGAGGACTGCGTAGAGAGCAGCTTCCAGCTCGGCCTTGTTGTCGTATAACGGCAGTTCCACACGGTT
GAAGCACGTGTGCACCTTGGGGAAGCCGCGAGTTTGCCCAGGCAACGGCCGCAACGAGAAGGGGCAAATGCGGCCGTCATAACTGGTTAACCCCTTGAAG
CCCTGCACTGGCACGCGCGATGAGCCCGTGGAGAACTGCAGGAATCGTGCACGTTCGTCCTCCGTGAACGCCTGAAGTACTTCCCAGAACCAGCCAACGA
CGTACGGGGCCTCGTCGAAACTGGGAGCGACCACGTGTTGCGCTTCCAGTCGGCGAGGTCGATCTCGGGAAGTCCGCACAGCACGAGCTCAAGCTCCTGG
TAGTCGAAGACCAGCAGCGCTTCCTGTGGGACGACCTCAAACAATCCAAGAGACAGAGCTTGCAACTGCGGCCCGTAGCGATCGAGCATGAGGTAGCGCA
GCTTGAGGTGCAGGAACTCTTGTTTGTTGGCGTCCGTCACGGGCTTGTCCCGTCCATCAGACACCAAGTCCACAGTCACGACTTCGTCATCCGCTCGTAG
CTCCGTGACGGAGAACGTGAGCTCCAGGGCGTCCACGCCGTCATTGTCTCGGATCCAGATCATGCTCGTGTACACCTCCGGGTCCACGTACTGCAGGTCC
GAGAAAGTGATTGGCGTGCCTAGGAAGTGCTTGAGAATGGGCAGACACAGCCGCGCCTGCATGGTCTGTCCTTCCAGCAGGGCGCGGCCTAGCAGTCTGC
CAATGCCCCGGAAGTAGAGCAAGTGGTCGGCCGTGCAGTCTTCAGAGTGCGGGTTAATAGCCACGGCCTGCGTGTGTCGGTGGCACGACATAAAGAGCCC
CAGCTCATCGTCCAGCAACCTGCCGAACAAGATGGAGAACCATTCTCGCTGCAGACCTCCGGCGTCGATACCTGCTTCCCCGACGAACTCGATGCGAAGC
GGGAAGTGAATGTGCTCGGGCTGAATGCCCAGCAACTGCTCCAT