Description :
From Genome Similarity Track
Location :
Scaffold_1:2763535- 2764742
Sequence
1207 bases(100 bases per row)
CCACTGACCGTCCGCATCTAAGTCCATAATCCAATTTTCCGTGAAAATGTCTGGCTGCAGTTTCAGCAGCCTGTCCCGTTTGAATGTCGGCGATAACGCG
AAACAGCGAAGCGAATCGAGGTTACGAACCCGAGACGCTGCCACGTAGAGGTGCTCGAAATCCCAGCCCGGAGAATTGGTTGATCCTTCAAGAAGGAGTA
TTACGCGGTCGAATGTGCTGCCCTGTGCTTTCCAAACGGTCAGCACCGTGGCGAGATCAACCGCGTGTTGGATGTAGCGGATATTCGACGTACCGCCGTC
GGCCCCTGCCAGCTTGATTGTAAAATTATCGTTGTTTGAGTGCATCGTCCCCACCGGATTCACCACGGTCTTTTTGTAACGGGTACTCCCATCTGGACCT
ATCGCCCAGTCTGTAGCTAGATTCATGTCCGATGGCCATTCAGCCCCGCTAAGTTCACCACCATCGCGATCGGCAAGCTGCACATTAATAAATTCGGGGG
CATAAGGCAAATCGACGATTGCTTGGTTGTTGCGGAGGGCCTCCTCCGCTAGGCGGGTGGCTTCCGCGGCCTTTTCATCGTCATCCCAACCAAGCGAGTG
GTACCAACATTTCGTCCGATTTGCAACTCCAAGTAGCACGTTCCCGTTCTCGTTGCCGAGAATTTGGCCCGGGGCACCACTAAAGAAATAACCAAATAGT
TCCGGAAACTCGTTTTCACGATAAATCAGCTCTGCTACAGCGTCTGGAATGTCAGTACCCAAAGTTTTACGCCAACGGAACAGAAGCCGGCGAGCCTGGG
CGGACAATAGCTTCACCATGCATCCGTTAAGTACCACGCGATCGAGATTGCCCGTCACAAGTATAACCGAGCTGTCTAACCACCTGGCATCTCTTGCTAC
GTCATCGGCTGTTAGCGGCTGCGTAAGCGAAGACACCATATCTTCATCCACGGGACGATACGACCCATCAGCAGCCCCCCCAGCGATTACCCTCTGGGTA
GAGCGCAGGGACGCGGCGAAACTTTTCTAGCAGTTGTTGCTGATCTTGACAGCCGCTAGCCCGCAATTGCGTTCGGAGCAAGGAGACCTTGAACAAACTA
AAAAGATACTTGGCCCTGATCAAAGTCGGATCCGACGTGCGCATGTAGAGGCATTTACAAAGCGACACTCCTCCGACGACAGGAAGCTGCCAGAAATCAC
CTGTCTA