Description :
From Genome Similarity Track
Location :
Scaffold_843:2763- 7708
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_843-fgenesh-gene-0.0Dual specificity tyrosine-phosphorylation-regulated kinase
Pytir_DAOMBR486maker-pir_contig_843-snap-gene-0.11Methylosome protein 50
Pytir_DAOMBR486maker-pir_contig_843-fgenesh-gene-0.1Late embryogenesis abundant protein

Sequence
4945 bases(100 bases per row)
CCGTGTGACTCCAAACACCACCACCACCACCACACCTCAGCCGTCTCATTCTCGCCACGGCGGTAATACCCCGACACCAAGAACACCGTCGCCGCCTCTG
GATCCGCCGTTCACACCGCAGTACACGCTGCGCAAGTTTGGTAGTGAGCTCACGGCGCTAGAAAAGCACGAAGTGCTCCAGTACGGCGACATTTTCTTCT
TCTCGTCGCTCGAGATCAAATCGCGGCGCCACAACGGGAAGATCTACAACTGCGCTGCAGCTTTCGATGAAGTCAAGTCGGGTCCAGTAGAAGAGAGTAC
TGGCGAGCCTTCACCACCAGAAGCTTCGGCACCAGCAGCTTCAGCACCAGCAGCTTCAGCACCAGTAGCTACAGAGCTCTTCAATGACGGCTACGACAAC
GAGCGTGGGGACTACCTCCTTCTTGCGCGGGACCACCTCGCGTTCCGCTTTGAAGTGCTTCACGTGCTGGGAAGCGGCTCGTTCGGCCAGGTCGTCTGCT
GTCTCGACCACCAGACCCAGCAGCAGGTCGCGGTCAAGATCATCCGGAACCGCAAAAAGTACAAAGAGCAGTCGCTCATCGAGGTGCAGATCCTCTCGCA
GCTGCAGACCGCCATGTCCAAGCGCTCAGCGTCCTCAGCTTCAGCTTCAGAATTGCATCACCCTGGTGGTGTCGATGCTTGCGTTGTCAAGATGCACGAG
TACTTTTTGTTCCGCAACCACTTGTGCATCTCATTTGAACTCCTGGGCATCAACTTGTACGAGTACCTGAAGCTCCGATTCTTCCAGGGGCTGCCGATGG
CCAACATCCGCGACATCGCCGCGCAACTCGTCGCGACGCTTAAGCTGCTGCATGCCCAGCGCGTGATCCATTGTGACCTCAAGCCCGAGAACATCCTGAT
CAAGCCCAAAAGCTCCCAGTCTGTATCGTCAACACCGTCGGTGTCCCAGCGGTCGCTGCAGCTCCTCAGTGCGCAGAACGCAACCACGGCGCAAGCGAGC
CTGCGCGTCGAAGAGATCTGCTTGATTGACTTTGGCAGCAGCTGCCTCGAGACCACTGCAGTGTTCACCTACATCCAGAGTCGCTTCTACCGCAGCCCCG
AGGTGATCCTCGGGTTTCCGTACAGCACAGCGATCGACATGTGGAGCCTCGGCTGCATCCTCGTCGAGCTCCACACCGGGTACCCGATCTTCGCTGGGGA
GAACGAGATCGAGCAGCTCGCGTGCATCATGGAGCTGTTTGGTGAGCCATCCCACGATCTACTCATGAGCTCGAGACGGCGCAAGCATTTCTTCACCGAG
AGCTCAAGCGCCAGTAGTTCAATGGCAACAGCAGTAGCAAACGCTGGTGGTGTCAATAGCTCCGATCCGCCAAGTCCTGAGCTGCTCACGTTCCAGGTAA
AACCATTTGTGAACTCGCGTGGTCGTAGGCGCACGCCAGGCTCACGCAGCCTGCTGAGCGCGATCAAGTCGGACGACGTGCAGTTCATTGAGTTTGTGCG
CAAGTGCCTCGTGATGGACCCTCGGAAGCGCATGACCCCGGAGCAGGCGGAGCACGACCCGTGGCTCCGATCTTCAACAGCAGGAACGGTATCAGGAGTG
CATGCTCACCATGATGTTGACGGCTGCGACAACCTTGATGATGCGGCAAGTCGCACGCACAGTATCTCATTGTCACAGGAGGTCATTGAAATCTAGCCTT
TGTCCAGTGTACCAACCTATTGACATGGGGAAATAGCAACACAAGCTCACACAAGAAGCAACCATAGCAAGGTGTCCATCCCACACTGACCTCTGTATAT
ATTTCTGCCGGGTCCTTACAAGTCAACTTGCTGCTGCTGGCGGTCCTCGACATTCCACGTCTGCATGGTCTTGTCCCAGGATGCGGTCGCCAACACAGTT
GAAGAAGAAGACGAAGCTAGGGCTGGTACTTGGAACCACTCGAGCGCGTGGACGTAGTCCGAGTGGTCAGCGTCAACTCGACTTGGCGTCTGCGAGCCGT
CTCTGACAAACACGCTTGCGTCGTCACCACCGGACGCGAGTAGGTCTTCGTGGAAACGGGAGTACTTGAGCGCGTGTACAGGTCCATCGTGGGGTGTCTA
CAATCGGCAGCACAAGCCAACAAGGAGTGGAGGAACCGATACAAAGTCAGACAAACCTCCAGTGTATCCGTAGTGTATTAGCGACAACTGCAGCAAGACT
TACCGATTCGAAGAGTAGCGTCGTGGGTGATCGCGTGTCGAACGTGAGCACCGAGCCGTTCTCCAAGCCCACGGAGAAGATCGATTCGTTGTGCGGGTGC
CAGTCGACCACGAGCGCAGGGAACTCGGTCGAGATCGTCTGCACAGCGTCTGTGGGCTGGCGGTCGTCCCAGATCTGCACCGTGCAGTCCTGCGACGCGG
ACGCGAGCAAATGCGCTGACTTGTGGTTCATCGCGACGCTCCAAATGAGATCAGTGTGGCCCTCGAGCGTCGCGATCGTCTTGTCCATACAGGAGATATC
CCACAACTTGACTCTATACAAATAAATAAGCAATAATGAACGCAAAGGGCCCATCACAACAACGTTTAGAGTGAGCGCTTGGACATCCACTATAAGAGCC
ACATCACATACACAATAATGGAGCACATAGAGTACGTACGTGAGGTCCCAGCTACCAGTGACGATCTTGGTCTTCTCAAACAGCGACGCGCTGACACTTG
CCACGACATCGTCGTGGCCCCAGCTTGCANNNNNNNNNNGGCACTCCCTCGTCCTCCTCTACGCCACCACTGGCATCACCATCAATCGCGCGACCGCCGC
CACTCTGTGGCAGGANNNNNNNNNNCGCCGTCGATCTGAGACGCGCGCACGAGTTCCACGTCGCCGTTGTCGCACGCGAGCGCCAGTACATCCCCGTCGA
CACCGCACCACGCGAGCGAGCTCACACCCGAGGCGAGTTGGAACGCGCAGAGCTGCTCGTAGCTGCTCGCGTCGATGAGCGAGACCACGCCGCCCCACTG
GTTGCCCTCGAGGTTGGACTGTGCGACTGCGAGCAGCGGGTGTGCAATACCTTCAGCGTCTTCGTCAGGAAGGCTACTACTGGTAGCTGCAGCAGACGTA
AGAGAGAAGGACGCGGCTGCGACGGCGTCGATCTGCGCGTTCGAGGCGTACACGCCGCTGCGCATTCTGGTCGCTTTGGCCGCCACCATTGCAATTGTTT
GTTGGATCCGCCTTGGTTTGAAATTGACAACCAAGAAAAGAGGCAATGTGAGGTCCTGGTGAAATGTGGTACACATTAAAATCGGGCAGACTTGTTGGCT
TCACTCTAAAATAGGGTTCTCGTTCCATGAATAAGGTGTCGCCTCAAATATTGATCTTTAAAGGCTGCAAAGTAGCCAGCCACTATGTGAATGCAACGGT
TAGAAGAAGGCGACAAGATGAGGCAGTTGGGTAGTACCGGCGTGTCTCTCGCATTCTCTTATGACTTCAAGCAGAGAGATCTTCGCACGGCAAAGCCACA
TTGCGGCGTGGGGGATCGGACATGATCACAGTTTTCAAAGTGCCTTCAGCTGCATACGCCCAAGCAACTGAGCCGACCGCAAGACTACCAAGCAAGCTAA
CCAAGCACCACCACCACTACCGAATCAACTACTGAACAATGCCGAGCCGCGTGTATGAAGTCTACCGAGGTCGCGACCACTCCCCAGGCGACCCGGCAGA
GCACCACCACTACGACAAGGACCACGACCACGACCTGGACGAGATGGCCGCGCGCCGCCGCGCACACATGGACGAACTCTATGAGCAAGGCAAGGGTCGC
GCAAAGGACACGGCCGAGCAGGCGCGCTACAAGCTCGAGGAGCTTCAGGAGCGCGCAAAGGACACGGCGGGGTATGCTCGCGGTCGCGCGGAAGATACTG
CCGAGTACGCGAGCAAGCGCGCCGGCGATATGAAGGACCGCGCTTATGAGTCTGCCGAATATGCTGGCAGGCGCGCTGGCGATATGAAGGACCGCGCTCG
TGAGTCTGCCGAATATGCTGGCAAGCGCGCTGGTGATATGAAGGACCGCGTACTGGATGCAGCTGGCAACGTGAAGGACCGCGTGCTCGAAGGTGCTGAG
GATGTCAAGGAGCGCGTGCTCGATAGCGCTGGCTATGCGCGTAAGCGTATGAGCGACGCTGAAGAGCGCGCTCGCGAGTCGGCCGAGTACGCGCGCGAGC
GTGCGGGTGACGTCGGAGAACGTGCTCGTGAGACTGCTGAACAAGCCCGTGAGAAGGTCGGTCGCGCAGCGGGTCAGGCCCGTGAGCGCGTTGAAGAGCT
CGGCGAGCACGCTCGTGAGCGTCTGGAGGAGCTGGGCGAGCACTCGCGCGAGCGTCTGGAAGGACTGTCAGAAGACGCGCGCGCACGCATGGAAGACGTC
AAGGAGCGCGTGAAGGACACGATGGGCTCGGCGCGCGGTCACGTCGAAGACACGTGGCACAAGAACGCGGACGCCGTCAAGGCCGTGGGCAGCCGAGAGT
ATTGCTTGACGCTACCGTCGAACCGCCGCATCTGCGCGCGTCACATGTTCCTAGTGCTGCCGCTGCTGCTGGTATTCGCCGTGCTGATCTACCGCCGCCG
CAACCCGGAGAAGTGGAAGGCCAAGATGAAGACGCTGCGCAAGCAGCGCGCCGCGCTCGAGAACAAGATGATGAGCGCGAAGGGTCAAGCGGTCGAGACG
CTCCGCGAGGGCGAGCGCAACATGGAGAAGAAGACGGAGCAGGCGAAGCAGTACGCGGCCGACCAGAAGGATGACTTTACGAGCAAGAAGGATCAGTGAG
CGAACGAGTGAGTCTCAATGAGCCGAAAAAGAAGTCGGAAAAGAAGATGATGATGCATGAATAGGGTGCTGACGATACGAACTGTCGTTCTGTGGCGATG
GATGGCTGGCTGAGCTGAGCTCTCTTGAACCGTGAGGATCTTTGT