Description :
From Genome Similarity Track
Location :
Scaffold_650:2763- 4641
Transcript NameFunction/comments
g17830.t1ETK82060.1 hypothetical protein L915_12493, partial [Phytophthora parasitica
g17831.t1KUF84562.1 hypothetical protein AM587_10003609 [Phytophthora nicotianae

Sequence
1878 bases(100 bases per row)
CGGACCGGATTCTGATGCATTCTCAGAGGATGCGGACGCCGACACCTTGGGTGCAGGACCGCGACGAGATACTTTGGCTGCTGGCGGCTTCTTCTGGCTC
AGGAACTGCTCCTGCTCGCGGAGGAGCTGCGCCAGCTCGGCGTCCATATCGGGCGCGTTCATTCTGATCACAAGTGAGGATTGATTGGCGGAAAAACAAA
AGTTGAACCTAAGTTTGAAACACAAAATAATAACATTATGTGTTCATACATCACTAACGCAGTGAAGCACTGGGCGAGACATCGCCATGGCCTCCCGTCG
GCGTCTACTGCAGCTGCTGCCACGCCGCGCCGGCCTCGCGCCCAGCTCCTCGCCGCTCCATGCCGCTCCCTGTCTTCAGACCGCTGACTCGCGTTTATAC
CGCGTGTCGGCCTCGAACGGTGCGAAAGGCCGTCGCGAGTCGCAGTCCAAGTCGCTCAGTCAGTTAGTGCTGGCGCTGCGCACTTTCCACGAATTGGAGC
GGCACTTCGCCGTGCCCTTCAGCTTCGTGGTGCCCCGTAGCATCATCTGGCCCAGGGAGCTACACCATCTGCCGCTCGGAGTGAAAGTGCACAGGTTCAT
GCAGGCGCTGGGCAAAGGCTCAGCTTCAGCAGTGGAGAGAACGAAGCAGGGCGCCGAGCAGCTGCAGGAGCTCAAGGCCATGGGTTTCCCGCTGCGCTCG
TGGCAGGAGTATCTGTTCCAAGAGGTGTGTCTCCCGGCGCTCCACACATACGCGGACCAGTACGGAGACCTGTTCGTGCCGCAGAAGTTTGTGGTGCCCG
AGGAAGACGAGGACGAGTCAGATCTCTGGCCTCGAGCCACGAGGGGGTACAAGCTCGGACTGGCCGTAGCCAAGCTGCGAAAACAGGTGCAGCAGCAGAA
ACAGAGAGAGCAGCAGCTCAAGGACAAGAAGAAACAGGCAGGCGACAAGCCGAAGGCCGTCTTGCCGCCCCTGCCAATGAATCAGGTGGAAGCGCTCAAT
GCGCTCGGGTTTGTGTGGAGAGTGCGAGACACCAAGTGGTATCAGTTTTTCCTCCCTGGTCTGCGGCGGTACAAGGAGCTGAATGGGAATGCGGACGTGC
CGTTGGCGTTTACGATCCCGTCCCACGCTGAAGATCCGAGATGGCCCAAGGTGCTGGAGGGATATATGCTGGGACGACATGTGTACATGGTGCGCTCGGG
GAAGTATGCGACGCAGGTTCGGGATAGCAAAGAGGAGCTGGATGAGCTCGGCTTCTCGTTTCGCCTCGTTGACAAGGTGTGGGGAGAAAGCATTTTCCCT
GCGCTCGAGGTCTTTGCTGCCCAGTATGGCCACTGCGACGTTGGTCAAGATTTTGTGGTGCCGTCCGATGAATCTTGGCCCCTCGATTCGTGGGGACTCA
AGCTGGGAGACACGGTCAAGAACATCCGGCGTGGAGCGTACGATTCTCAAGTGCAAGCATCTCGCAAAGAGCTTGACGCTCTAGGTTTCGTGTGGAACGC
GCGCCATCGTGTAGAGAAGACTGTGCGCAGCGTGGTGATCCCAGCTCTGACCACCTATCGGCGACTGCATGGCAGCGATGCCCTGGTGACGACGGACTTT
GTGGTACCCGATCGGGACCCCAACTGGCCCGTATTGACGCGTGGCTTTAAGCTTGGTCAGTGGATTACTCGTGTACGATCGGGCCAGGTGGCGCTTTCGT
CCAAGTTGCGAGCTGAGTTGGATAAGGTTGGGTTTGTGTGGCGCTCCAACGACCAGCGTTGGAATGATGTTCTACTGCCGGCCTTCCGTGCTTACGCTGA
GCTCCATGGTGGTACTTGTACGTCGATGAGCACGAAGTTCTCAGTTCCTCCTGAGGTGCCGTATCCCCGCGCAGCCTG