Description :
From Genome Similarity Track
Location :
Scaffold_345:27626- 29645
Transcript NameFunction/comments
Phyta_totarag7353hypothetical protein PHYSODRAFT_337674

Sequence
2019 bases(100 bases per row)
GAAGTATCTGGAGTTCGAGCTTCACCATCTGCAAGCATTGTGGGATTCCACGCACTTCTTGCCGATCTCTATGTTGGCTGGCGATCCTGTTATAGCTGCC
TACCACAAAAATCGGCGCCAGCGGCGAAGTCGTGCGGGGACCGTATGGAAGAAGTATCTTGGGTACGTGATAACTGCACTATACCTGCTTCAATGCGACC
TGGATGTGCTTCTCGATCCTTACTTCCTTTATTTTCCGAAATCGCGAATGCCCAAGGAGTGGTACCCGCAGCTGGACTGTAGTGGTGGAATACTCGCAGA
CGCCTTCAGGATCTTCGACCTCCAAGACCCGTGGCGGAACCAGTTTCGGCACTGTCCTGCGGAACGTCCCGCAACGCATATCGCTCGCCTCGAGGACAAT
TCGTGCCGCCAGCCAAAGGTCCGCGATCTTCGATCACGGGTGCCGCAGGCACCGAAACGTTGTAGCGTAATCCTCCAAGTCAAAACTTCAGCTCCAGTTA
TATTTGTTCTTGGTCGTAGTTGTCTCGATTCCACTCCGCATCAGTTGATCTGGATCATTATTTGGAACCCAGCTGATCACGGGTCTGCATTCCACATTTC
TTCACCAAGCCACCTCCTTTTTCTTTACGGAGACCGCATGTGCGGTCCACGTCTTCGGTCGGGGCAGCCAATTCTTCCAGATCGGTTTACTCAATCACGA
ACACCATTCCTCCTGATATGCGACCTCCTAGCAGATCTTTCACCCAACCACTTTGCGAGGTGACCGACTCACCCCACGAGTGCGCCACTTCTCCTCGTGG
CCTCAAACTGATTTTGGTTGGCTTGCTCGCACAGGTAATCGTGCAATATAGCTCCGTAGTTAAGATCGGCTTCGTCCACCCAGATTAGCGCGGTCTATCC
TTTCCAGTGTACCAGCAATTCTCGTAGCACTCTGTTCGCGTCCAGATCGCACTTAGGTGGTGCATTCCACCTCAGATTCATCTTCGCCAAGCTCTGTCTC
CCAGCTATcttcaagcagcaaagcTTCACCAAAGTCGAGTCGATCTTGACCTTGGACGGCTAATCGATGACGTGGACGATCGGAAAATTCTCGCACGGGC
TTGATCTTCAACACCTGGATCACGGGGAACACGTTGTACGTGGTGCCAGCGGTCTCCAGTCTCACGGCATGTTCGTCGATCTTTTCGACTACTCGGAATT
GTCCGTGCCACATGTGTGCCAACTTCCGCGCATATTCTTCTTTCACCCTGTCCAGATACAACCAGACTTGGATGCCAACTTCGACCTCGTGCGGACGCAG
GGAGCCGTTGTGCCGAGCTGCTCTGTTCTGGATAGCTTGGCGTAGGTACTCGTTCACTTGCTCACGCGCCTGCTGGTAGTGTTTCTAAACATGGTAGCAC
CACCTTCGAGTCACAATCTCCACGTCGCGTCGATTCCAGCGAGACCATCGCTTCCAGCGTTGATCATAGGTCCCATCCGCGCATCAATTAGAAAGGCTTG
TCACTGCGCACTCGGTCGTGAGCCGCGTTGAGAGCAAACGTAAGACGTTCAGCGTACTCGTCCCAATTCTTCTGGTTGACATCTGCAGCATATATCTTCA
AGATCGCGTCAATGTCTGCACCATCCTTTCGGCTGTACCGTGCGCCTGCGGGCGATAAGCCGTAGTCGCTCTTTGCCGTTGTCCGGCGCTCTTGTTGAAC
GATCTGAAGAAGTCAGGCATAAAGCCTGGCTCTCGATCGTGCCGGATGACTTCACTTGCGCCAAATCGTCGGGAAACACATTCCTCGTAGTGCTCCGCTA
TTGTCTGAGCAGTTCTTGATGTACTAGTTTTGGCGATCACAAAGCCTGTGAAGATATCGACCCAGATCAATAGTTCCGTGTTGCTCTTGTACGACTTCGA
CAGCGATGGGGTGTGGTCCATAGCGATAATATCAAACGGGTACGTGGCCTGTAGGTTCCCCTCAGACAGTCGGCCTTCTTTTCCCAGTCTCACAATCTAT
GCCGTGACCCACGTAGCGC